MirGeneDB

MirGeneDB ID

Aca-Mir-5452

Family name MIR-5452 (all species)
Seed GGCCCUC
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-5452
Paralogues
Orthologues
Node of Origin (locus) A. carolinensis
Node of Origin (family) A. carolinensis
Genome context
(anoCar2)
GL343282.1: 1468406-1468464 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-5452)
Mir-5452 GL343282.1: 1468406-1468464 [+] UCSC Ensembl
Mir-5408 GL343282.1: 1472528-1472585 [-] UCSC Ensembl
Mir-5406 GL343282.1: 1474914-1474970 [-] UCSC Ensembl
Mir-5407 GL343282.1: 1475314-1475373 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCAUCUCCUAAAACGGAAGGGGGGCACCUUUGGCCCUCCUGUUGCUGCUGGAGUCCAGCUCUCAAUCCAACAACAGCCGGAGGGCUGGAGGUUCCCCACCUCAGGUCUGAAACAAGGAG
Get precursor sequence
Structure
        10         20         30        40        50         
GCAUCUCCUAAAACGGA-   -|   C     UG       U    C  C    GUCCAG 
                  AGG GGGG ACCUU  GCCCUCC GUUG UG UGGA      \
                  UCC CCCC UGGAG  CGGGAGG CGAC AC ACCU      C
GAGGAACAAAGUCUGGAC   A^   U     GU       C    A  A    AACUCU 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-5452_5p

MirBase accessionMIMAT0022075
Sequence
0- UGGCCCUCCUGUUGCUGCUGGA -22
Get sequence
Star sequence

Aca-Mir-5452_3p*

MirBase accessionMIMAT0022076
Sequence
37- CAACAACAGCCGGAGGGCUGGA -59
Get sequence