MirGeneDB

MirGeneDB ID

Aca-Mir-5408

Family name MIR-5408 (all species)
Seed UAUCUCC
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-5408a
Paralogues
Orthologues
Node of Origin (locus) A. carolinensis
Node of Origin (family) A. carolinensis
Genome context
(anoCar2)
GL343282.1: 1472528-1472585 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-5408)
Mir-5452 GL343282.1: 1468406-1468464 [+] UCSC Ensembl
Mir-5408 GL343282.1: 1472528-1472585 [-] UCSC Ensembl
Mir-5406 GL343282.1: 1474914-1474970 [-] UCSC Ensembl
Mir-5407 GL343282.1: 1475314-1475373 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GACGCGUGGUUCCCUCAGAGGGUUUGGACUCUAUCUCCCAUAAUGCUUAGCCGUAGCUCCGAGUGGCUAAGACUUCUGGGAGUUGAAGUUCCAACCCCCUAGAAACCCCGCCUUGGCA
Get precursor sequence
Structure
        10          20        30        40        50        
GACGCGUGGUUCCCUCA--|A     U     C  U      UAAUG       GUAGC 
                   G GGGUU GGACU UA CUCCCA     CUUAGCC     U
                   C CCCAA CUUGA GU GAGGGU     GAAUCGG     C
ACGGUUCCGCCCCAAAGAU^C     C     A  U      CUUCA       UGAGC 
      110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-5408_5p

MirBase accessionMIMAT0022024
Sequence
0- CUAUCUCCCAUAAUGCUUAGCC -22
Get sequence
Star sequence

Aca-Mir-5408_3p*

MirBase accessionMIMAT0022025
Sequence
36- CUAAGACUUCUGGGAGUUGAAG -58
Get sequence