MirGeneDB

MirGeneDB ID

Aca-Mir-5406

Family name MIR-5406 (all species)
Seed UUUAGAC
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-5406
Paralogues
Orthologues
Node of Origin (locus) A. carolinensis
Node of Origin (family) A. carolinensis
Genome context
(anoCar2)
GL343282.1: 1474914-1474970 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-5406)
Mir-5452 GL343282.1: 1468406-1468464 [+] UCSC Ensembl
Mir-5408 GL343282.1: 1472528-1472585 [-] UCSC Ensembl
Mir-5406 GL343282.1: 1474914-1474970 [-] UCSC Ensembl
Mir-5407 GL343282.1: 1475314-1475373 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GAGUCCUGGAUGUUUGGGGACAGUUCUUCCUUUUAGACUGGCACUCCUAGAAUCUCUCCGAACAUCUAGGAGCGAAACUCUAAAAGAAGAACCUCUCUCCCUCUGCUUUGAAAGUCC
Get precursor sequence
Structure
        10            20        30        40        50        
GAGUCCUGGAUGUUUGG----|  CA       C       CUGGCA        AUCUCU 
                     GGA  GUUCUUC UUUUAGA      CUCCUAGA      \
                     UCU  CAAGAAG AAAAUCU      GAGGAUCU      C
CCUGAAAGUUUCGUCUCCCUC^  C-       -       CAAAGC        ACAAGC 
     110       100         90         80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-5406_5p

MirBase accessionMIMAT0022020
Sequence
0- UUUUAGACUGGCACUCCUAGA -21
Get sequence
Star sequence

Aca-Mir-5406_3p*

MirBase accessionMIMAT0022021
Sequence
36- UAGGAGCGAAACUCUAAAAGA -57
Get sequence