MirGeneDB

MirGeneDB ID

Aca-Mir-1662

Family name MIR-1662 (all species)
Seed UGACAUC
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-1662
Paralogues
Orthologues Ami-Mir-1662  Cli-Mir-1662  Cpi-Mir-1662  Gga-Mir-1662  Tgu-Mir-1662  Xtr-Mir-1662 
Node of Origin (locus) Tetrapoda
Node of Origin (family) Tetrapoda
Genome context
(anoCar2)
6: 2558253-2558313 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CGAUGUUGUGCAUAGCUACGCACUGUGGGCUUGACAUCAUCCUACUUGAGAUGUAAUGUAAUGCAAAGUCCCAAGUAGGUUGAUGUCUGGCCCAAGAUGGCUGCAGUCUUGCCAUGCCUUA
Get precursor sequence
Structure
        10         20         30        40        50          
CGAUGUUGUGCAUAGCUAC-  ACUG-|     U       U        A   GUAAUGU 
                    GC     UGGGCU GACAUCA CCUACUUG GAU       \
                    CG     ACCCGG CUGUAGU GGAUGAAC CUG       A
AUUCCGUACCGUUCUGACGU  GUAGA^     U       U        C   AAACGUA 
 .       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-1662_5p

MirBase accessionMIMAT0021794
Sequence
0- UUGACAUCAUCCUACUUGAGAU -22
Get sequence
Star sequence

Aca-Mir-1662_3p*

MirBase accessionMIMAT0021795
Sequence
39- CCCAAGUAGGUUGAUGUCUGGC -61
Get sequence