MirGeneDB

Gene name

Pfl-Mir-10-P1

Family name MIR-10 (all species)
MiRBase ID
Paralogues Pfl-Mir-10-P2  Pfl-Mir-10-P3 
Orthologues Aca-Mir-10-P1a-v1  Aca-Mir-10-P1a-v2  Aca-Mir-10-P1b-v1  Aca-Mir-10-P1b-v2  Aca-Mir-10-P1c-v1  Aca-Mir-10-P1c-v2  Ami-Mir-10-P1a-v1  Ami-Mir-10-P1a-v2  Ami-Mir-10-P1b-v1  Ami-Mir-10-P1b-v2  Ami-Mir-10-P1c-v1  Ami-Mir-10-P1c-v2  Asu-Mir-10-P1  Bfl-Mir-10-P1-v1  Bfl-Mir-10-P1-v2  Bta-Mir-10-P1a-v1  Bta-Mir-10-P1a-v2  Bta-Mir-10-P1b-v1  Bta-Mir-10-P1b-v2  Cel-Mir-10-P1  Cfa-Mir-10-P1a-v1  Cfa-Mir-10-P1a-v2  Cfa-Mir-10-P1b-v1  Cfa-Mir-10-P1b-v2  Cgi-Mir-10-P1  Cli-Mir-10-P1a-v1  Cli-Mir-10-P1a-v2  Cli-Mir-10-P1b-v1  Cli-Mir-10-P1b-v2  Cli-Mir-10-P1c-v1  Cli-Mir-10-P1c-v2  Cpi-Mir-10-P1a-v1  Cpi-Mir-10-P1a-v2  Cpi-Mir-10-P1b-v1  Cpi-Mir-10-P1b-v2  Cpi-Mir-10-P1c-v1  Cpi-Mir-10-P1c-v2  Cpo-Mir-10-P1a-v1  Cpo-Mir-10-P1a-v2  Cpo-Mir-10-P1b-v1  Cpo-Mir-10-P1b-v2  Cte-Mir-10-P1  Dme-Mir-10-P1  Dno-Mir-10-P1a-v1  Dno-Mir-10-P1a-v2  Dno-Mir-10-P1b-v1  Dno-Mir-10-P1b-v2  Dpu-Mir-10-P1  Dre-Mir-10-P1a1-v1  Dre-Mir-10-P1a1-v2  Dre-Mir-10-P1a2-v1  Dre-Mir-10-P1a2-v2  Dre-Mir-10-P1b1-v1  Dre-Mir-10-P1b1-v2  Dre-Mir-10-P1b2-v1  Dre-Mir-10-P1b2-v2  Dre-Mir-10-P1c-v1  Dre-Mir-10-P1c-v2  Efe-Mir-10-P1e  Efe-Mir-10-P1f  Ete-Mir-10-P1a-v1  Ete-Mir-10-P1a-v2  Ete-Mir-10-P1b-v1  Ete-Mir-10-P1b-v2  Gga-Mir-10-P1a-v1  Gga-Mir-10-P1a-v2  Gga-Mir-10-P1b-v1  Gga-Mir-10-P1b-v2  Hsa-Mir-10-P1a-v1  Hsa-Mir-10-P1a-v2  Hsa-Mir-10-P1b-v1  Hsa-Mir-10-P1b-v2  Isc-Mir-10-P1  Lgi-Mir-10-P1  Mdo-Mir-10-P1a-v1  Mdo-Mir-10-P1a-v2  Mdo-Mir-10-P1b-v1  Mdo-Mir-10-P1b-v2  Mml-Mir-10-P1a-v1  Mml-Mir-10-P1a-v2  Mml-Mir-10-P1b-v1  Mml-Mir-10-P1b-v2  Mmu-Mir-10-P1a-v1  Mmu-Mir-10-P1a-v2  Mmu-Mir-10-P1b-v1  Mmu-Mir-10-P1b-v2  Ocu-Mir-10-P1a-v1  Ocu-Mir-10-P1a-v2  Ocu-Mir-10-P1b-v1  Ocu-Mir-10-P1b-v2  Pmi-Mir-10-P1  Rno-Mir-10-P1a-v1  Rno-Mir-10-P1a-v2  Rno-Mir-10-P1b-v1  Rno-Mir-10-P1b-v2  Sha-Mir-10-P1a-v1  Sha-Mir-10-P1a-v2  Sha-Mir-10-P1b-v1  Sha-Mir-10-P1b-v2  Sko-Mir-10-P1  Spu-Mir-10-P1  Tca-Mir-10-P1  Xtr-Mir-10-P1a-v1  Xtr-Mir-10-P1a-v2  Xtr-Mir-10-P1b-v1  Xtr-Mir-10-P1b-v2  Xtr-Mir-10-P1c-v1  Xtr-Mir-10-P1c-v2 
Node of Origin (gene) Bilateria
Node of Origin (family) Eumetazoa
Genome context
(Pfl)
LD344867.1: 476557-476616 [+]
Precursor
(pre-Mir +30nt flank)
GACGUGAUUAGCAGCGUCUCCUUCUACCCGUACCCUGUAGAUCCGAAUUUGUGAUUAUUUGAAGACACGAAUUCGUUUCUACGGGUGACAGGUCGUAGUGAGGAAUCCAGCGGGCGAGCU
Get precursor sequence
Structure
        10         20         30        40        50         
GACGUGAUUAGCAGCGU-   -| UCU   C  AC        UC          AUUAU 
                  CUC CU   ACC GU  CCUGUAGA  CGAAUUUGUG     U
                  GAG GA   UGG CA  GGGCAUCU  GCUUAAGCAC     U
UCGAGCGGGCGACCUAAG   U^ UGC   A  GU        UU          AGAAG 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsCNNC at 3p(+17)
Tissue expression
 +
Pt
Mature sequence

Pfl-Mir-10-P1_5p

MirBase accessionNone
Sequence
0- UACCCUGUAGAUCCGAAUUUGUG -23
Get sequence
Seed sequenceACCCUGU
Star sequence

Pfl-Mir-10-P1_3p* (predicted)

MirBase accessionNone
Sequence
37- CGAAUUCGUUUCUACGGGUGACA -60
Get sequence