MirGeneDB

Gene name

Pfl-Mir-10-P2

Family name MIR-10 (all species)
MiRBase ID
Paralogues Pfl-Mir-10-P1  Pfl-Mir-10-P3 
Orthologues Aca-Mir-10-P2a  Aca-Mir-10-P2b  Aca-Mir-10-P2c  Ami-Mir-10-P2a  Ami-Mir-10-P2b  Ami-Mir-10-P2c  Asu-Mir-10-P2l  Asu-Mir-10-P2m  Asu-Mir-10-P2n  Asu-Mir-10-P2o  Asu-Mir-10-P2p  Asu-Mir-10-P2q  Bfl-Mir-10-P2-v1  Bfl-Mir-10-P2-v2  Bta-Mir-10-P2a  Bta-Mir-10-P2b  Bta-Mir-10-P2c  Cel-Mir-10-P2  Cfa-Mir-10-P2a  Cfa-Mir-10-P2b  Cfa-Mir-10-P2c  Cgi-Mir-10-P2  Cli-Mir-10-P2a  Cli-Mir-10-P2b  Cpi-Mir-10-P2a  Cpi-Mir-10-P2b  Cpi-Mir-10-P2c  Cpo-Mir-10-P2a  Cpo-Mir-10-P2b  Cpo-Mir-10-P2c  Cte-Mir-10-P2  Dme-Mir-10-P2  Dno-Mir-10-P2a  Dno-Mir-10-P2b  Dpu-Mir-10-P2  Dre-Mir-10-P2a1  Dre-Mir-10-P2a2  Dre-Mir-10-P2b1  Dre-Mir-10-P2b2  Efe-Mir-10-P2g  Efe-Mir-10-P2h  Efe-Mir-10-P2i  Efe-Mir-10-P2j  Efe-Mir-10-P2k  Ete-Mir-10-P2a  Ete-Mir-10-P2b  Ete-Mir-10-P2c  Gga-Mir-10-P2a  Gga-Mir-10-P2b  Hsa-Mir-10-P2a  Hsa-Mir-10-P2b  Hsa-Mir-10-P2c  Isc-Mir-10-P2  Lgi-Mir-10-P2  Mdo-Mir-10-P2a  Mml-Mir-10-P2a  Mml-Mir-10-P2b  Mml-Mir-10-P2c  Mmu-Mir-10-P2a  Mmu-Mir-10-P2b  Mmu-Mir-10-P2c  Ocu-Mir-10-P2a  Ocu-Mir-10-P2b  Pmi-Mir-10-P2  Rno-Mir-10-P2a  Rno-Mir-10-P2b  Rno-Mir-10-P2c  Sha-Mir-10-P2a  Sha-Mir-10-P2b  Sha-Mir-10-P2c  Sko-Mir-10-P2  Spu-Mir-10-P2e  Spu-Mir-10-P2f  Tca-Mir-10-P2  Xtr-Mir-10-P2b  Xtr-Mir-10-P2c 
Node of Origin (gene) Bilateria
Node of Origin (family) Eumetazoa
Genome context
(Pfl)
LD349317.1: 44526-44584 [-]
Precursor
(pre-Mir +30nt flank)
AGGUAACUCAGCCGACUGCCAGAUUGCUUAAACCCGUAGAUCCGAACUUGUGUUAGGGUUCGGCUCGCAAGCUCGCAUCUAUGGGUCUAUGUCGUCAUGGCAAAACACACCUGGCUGAC
Get precursor sequence
Structure
        10         20         30        40        50         
AGGUAACUCAGCCGACU-    -|  U  U  A          C   A      UUAGGG 
                  GCCA GAU GC UA ACCCGUAGAU CGA CUUGUG      \
                  CGGU CUG UG AU UGGGUAUCUA GCU GAACGC      U
CAGUCGGUCCACACAAAA    A^  C  U  C          C   C      UCGGCU 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
Pt
Mature sequence

Pfl-Mir-10-P2_5p

MirBase accessionNone
Sequence
0- AACCCGUAGAUCCGAACUUGUG -22
Get sequence
Seed sequenceACCCGUA
Star sequence

Pfl-Mir-10-P2_3p*

MirBase accessionNone
Sequence
37- CAAGCUCGCAUCUAUGGGUCUA -59
Get sequence