MirGeneDB

MirGeneDB ID

Asu-Mir-10-P1

Family name MIR-10 (all species)
Seed ACCCUGU
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-57
Paralogues Asu-Mir-10-P2o1  Asu-Mir-10-P2o2  Asu-Mir-10-P2o3  Asu-Mir-10-P2o4  Asu-Mir-10-P2o5  Asu-Mir-10-P2o6  Asu-Mir-10-P3  Asu-Mir-10-P4 
Orthologues Aae-Mir-10-P1-v1  Aae-Mir-10-P1-v2  Aca-Mir-10-P1a-v1  Aca-Mir-10-P1a-v2  Aca-Mir-10-P1b-v1  Aca-Mir-10-P1b-v2  Aca-Mir-10-P1c-v1  Aca-Mir-10-P1c-v2  Ami-Mir-10-P1a-v1  Ami-Mir-10-P1a-v2  Ami-Mir-10-P1b-v1  Ami-Mir-10-P1b-v2  Ami-Mir-10-P1c-v1  Ami-Mir-10-P1c-v2  Bfl-Mir-10-P1-v1  Bfl-Mir-10-P1-v2  Bge-Mir-10-P1-v1  Bge-Mir-10-P1-v2  Bta-Mir-10-P1a-v1  Bta-Mir-10-P1a-v2  Bta-Mir-10-P1b-v1  Bta-Mir-10-P1b-v2  Cbr-Mir-10-P1  Cel-Mir-10-P1  Cfa-Mir-10-P1a-v1  Cfa-Mir-10-P1a-v2  Cfa-Mir-10-P1b-v1  Cfa-Mir-10-P1b-v2  Cgi-Mir-10-P1  Cli-Mir-10-P1a-v1  Cli-Mir-10-P1a-v2  Cli-Mir-10-P1b-v1  Cli-Mir-10-P1b-v2  Cli-Mir-10-P1c-v1  Cli-Mir-10-P1c-v2  Cpi-Mir-10-P1a-v1  Cpi-Mir-10-P1a-v2  Cpi-Mir-10-P1b-v1  Cpi-Mir-10-P1b-v2  Cpi-Mir-10-P1c-v1  Cpi-Mir-10-P1c-v2  Cpo-Mir-10-P1a-v1  Cpo-Mir-10-P1a-v2  Cpo-Mir-10-P1b-v1  Cpo-Mir-10-P1b-v2  Cte-Mir-10-P1  Dan-Mir-10-P1  Dme-Mir-10-P1  Dmo-Mir-10-P1  Dno-Mir-10-P1a-v1  Dno-Mir-10-P1a-v2  Dno-Mir-10-P1b-v1  Dno-Mir-10-P1b-v2  Dpu-Mir-10-P1-v1  Dpu-Mir-10-P1-v2  Dre-Mir-10-P1a1-v1  Dre-Mir-10-P1a1-v2  Dre-Mir-10-P1a2-v1  Dre-Mir-10-P1a2-v2  Dre-Mir-10-P1b1-v1  Dre-Mir-10-P1b1-v2  Dre-Mir-10-P1b2-v1  Dre-Mir-10-P1b2-v2  Dre-Mir-10-P1c-v1  Dre-Mir-10-P1c-v2  Efe-Mir-10-P1e  Efe-Mir-10-P1f  Ete-Mir-10-P1a-v1  Ete-Mir-10-P1a-v2  Ete-Mir-10-P1b-v1  Ete-Mir-10-P1b-v2  Gga-Mir-10-P1a-v1  Gga-Mir-10-P1a-v2  Gga-Mir-10-P1b-v1  Gga-Mir-10-P1b-v2  Hme-Mir-10-P1-v1  Hme-Mir-10-P1-v2  Hsa-Mir-10-P1a-v1  Hsa-Mir-10-P1a-v2  Hsa-Mir-10-P1b-v1  Hsa-Mir-10-P1b-v2  Isc-Mir-10-P1-v1  Isc-Mir-10-P1-v2  Lan-Mir-10-P1g  Lan-Mir-10-P1h  Lgi-Mir-10-P1  Mdo-Mir-10-P1a-v1  Mdo-Mir-10-P1a-v2  Mdo-Mir-10-P1b-v1  Mdo-Mir-10-P1b-v2  Mml-Mir-10-P1a-v1  Mml-Mir-10-P1a-v2  Mml-Mir-10-P1b-v1  Mml-Mir-10-P1b-v2  Mmu-Mir-10-P1a-v1  Mmu-Mir-10-P1a-v2  Mmu-Mir-10-P1b-v1  Mmu-Mir-10-P1b-v2  Oan-Mir-10-P1a-v1  Oan-Mir-10-P1a-v2  Oan-Mir-10-P1b-v1  Oan-Mir-10-P1b-v2  Ocu-Mir-10-P1a-v1  Ocu-Mir-10-P1a-v2  Ocu-Mir-10-P1b-v1  Ocu-Mir-10-P1b-v2  Pfl-Mir-10-P1  Pmi-Mir-10-P1  Rno-Mir-10-P1a-v1  Rno-Mir-10-P1a-v2  Rno-Mir-10-P1b-v1  Rno-Mir-10-P1b-v2  Sha-Mir-10-P1a-v1  Sha-Mir-10-P1a-v2  Sha-Mir-10-P1b-v1  Sha-Mir-10-P1b-v2  Sko-Mir-10-P1  Spu-Mir-10-P1  Sto-Mir-10-P1a-v1  Sto-Mir-10-P1a-v2  Sto-Mir-10-P1b-v1  Sto-Mir-10-P1b-v2  Tca-Mir-10-P1-v1  Tca-Mir-10-P1-v2  Tgu-Mir-10-P1a-v1  Tgu-Mir-10-P1a-v2  Tgu-Mir-10-P1b-v1  Tgu-Mir-10-P1b-v2  Xtr-Mir-10-P1a-v1  Xtr-Mir-10-P1a-v2  Xtr-Mir-10-P1b-v1  Xtr-Mir-10-P1b-v2  Xtr-Mir-10-P1c-v1  Xtr-Mir-10-P1c-v2 
Node of Origin (locus) Bilateria
Node of Origin (family) Eumetazoa
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold565: 199541-199602 [-]
Precursor
(pre-Mir +30nt flank)
AUUCGAGAUAUUGAAUGCGGUGGUUUCGUCUACCCUGUAGUACCGAGCUGUGUUUGAGUGAUUAUGCAUACACGAUCGGUUGCCGGGUGAAUGACGCUGCCCAUAUAUUUUCCAUUUACCGU
Get precursor sequence
Structure
        10           20        30        40        50        60 
AUUCGAGAUAUUGAAUGC---| UG  U    C     U   GU     GC     UUGAGUG 
                     GG  GU UCGU UACCC GUA  ACCGA  UGUGU       A
                     CC  CG AGUA GUGGG CGU  UGGCU  GCACA       U
UGCCAUUUACCUUUUAUAUAC^ GU  C    A     C   --     A-     UACGUAU 
120       110       100        90          80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Mature sequence

Asu-Mir-10-P1_5p

MirBase accessionMIMAT0021464
Sequence
0- UACCCUGUAGUACCGAGCUGUGUU -24
Get sequence
Star sequence

Asu-Mir-10-P1_3p*

MirBase accessionMIMAT0021465
Sequence
39- ACACGAUCGGUUGCCGGGUGAAU -62
Get sequence