MirGeneDB

Gene name

Mmu-Mir-199-P2-v3

Family name MIR-199 (all species)
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-199a-1
Paralogues Mmu-Mir-199-P1-v1  Mmu-Mir-199-P1-v2  Mmu-Mir-199-P1-v3  Mmu-Mir-199-P2-v1  Mmu-Mir-199-P2-v2  Mmu-Mir-199-P3-v1  Mmu-Mir-199-P3-v2  Mmu-Mir-199-P3-v3 
Orthologues Aca-Mir-199-P2-v1  Aca-Mir-199-P2-v2  Aca-Mir-199-P2-v3  Ami-Mir-199-P2-v1  Ami-Mir-199-P2-v2  Ami-Mir-199-P2-v3  Bta-Mir-199-P2-v1  Bta-Mir-199-P2-v2  Bta-Mir-199-P2-v3  Cfa-Mir-199-P2-v1  Cfa-Mir-199-P2-v2  Cfa-Mir-199-P2-v3  Cpi-Mir-199-P2-v1  Cpi-Mir-199-P2-v2  Cpi-Mir-199-P2-v3  Cpo-Mir-199-P2-v1  Cpo-Mir-199-P2-v2  Cpo-Mir-199-P2-v3  Dre-Mir-199-P2-v1  Dre-Mir-199-P2-v2  Dre-Mir-199-P2-v3  Ete-Mir-199-P2-v1  Ete-Mir-199-P2-v2  Ete-Mir-199-P2-v3  Hsa-Mir-199-P2-v1  Hsa-Mir-199-P2-v2  Hsa-Mir-199-P2-v3  Mdo-Mir-199-P2-v1  Mdo-Mir-199-P2-v2  Mdo-Mir-199-P2-v3  Mml-Mir-199-P2-v1  Mml-Mir-199-P2-v2  Mml-Mir-199-P2-v3  Ocu-Mir-199-P2-v1  Ocu-Mir-199-P2-v2  Ocu-Mir-199-P2-v3  Sha-Mir-199-P2-v1  Sha-Mir-199-P2-v2  Sha-Mir-199-P2-v3  Xtr-Mir-199-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(mm10)
chr9: 21496498-21496559 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-199-P2-v3)
Mir-199-P2-v1 chr9: 21496498-21496559 [-] UCSC Ensembl
Mir-199-P2-v2 chr9: 21496498-21496559 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCUGAGGAACUGAACAGCCAUCCCCGCCAUCCCAGUGUUCAGACUACCUGUUCAGGAGGCUGGGACAUGUACAGUAGUCUGCACAUUGGUUAGGCUGGGCUUGGGCCAGCAGCAACAGUGGG
Get precursor sequence
Structure
        10         20         30        40        50        60 
GCUGAGGAACUGAACAG-   UC   -|  AUC       U        C   U AGGAGGC 
                  CCA  CCC GCC   CCAGUGU CAGACUAC UGU C       \
                  GGU  GGG CGG   GGUUACA GUCUGAUG ACA G       U
GGGUGACAACGACGACCG   UC   U^  AUU       C        -   U UACAGGG 
120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Star sequence

Mmu-Mir-199-P2-v3_5p*

MirBase accessionMIMAT0000229
Sequence
0- CCCAGUGUUCAGACUACCUGUUC -23
Get sequence
Validated targets microrna.org: MIMAT0000229
TargetScanVert: mmu-miR-199a-5p
miRDB: MIMAT0000229
Mature sequence

Mmu-Mir-199-P2-v3_3p

MirBase accessionMIMAT0000230
Sequence
41- CAGUAGUCUGCACAUUGGUUA -62
Get sequence
Seed sequenceAGUAGUC
Validated targets microrna.org: MIMAT0000230
TargetScanVert: mmu-miR-199a-3p
miRDB: MIMAT0000230