MirGeneDB

Gene name

Cpi-Mir-199-P2-v1

Family name MIR-199 (all species)
Species Western painted turtle (Chrysemys picta bellii)
MiRBase ID cpi-mir-199-1
Paralogues Cpi-Mir-199-P1-v1  Cpi-Mir-199-P1-v2  Cpi-Mir-199-P1-v3  Cpi-Mir-199-P2-v2  Cpi-Mir-199-P2-v3  Cpi-Mir-199-P3-v1  Cpi-Mir-199-P3-v2  Cpi-Mir-199-P3-v3 
Orthologues Aca-Mir-199-P2-v1  Aca-Mir-199-P2-v2  Aca-Mir-199-P2-v3  Ami-Mir-199-P2-v1  Ami-Mir-199-P2-v2  Ami-Mir-199-P2-v3  Bta-Mir-199-P2-v1  Bta-Mir-199-P2-v2  Bta-Mir-199-P2-v3  Cfa-Mir-199-P2-v1  Cfa-Mir-199-P2-v2  Cfa-Mir-199-P2-v3  Cpo-Mir-199-P2-v1  Cpo-Mir-199-P2-v2  Cpo-Mir-199-P2-v3  Dre-Mir-199-P2-v1  Dre-Mir-199-P2-v2  Dre-Mir-199-P2-v3  Ete-Mir-199-P2-v1  Ete-Mir-199-P2-v2  Ete-Mir-199-P2-v3  Hsa-Mir-199-P2-v1  Hsa-Mir-199-P2-v2  Hsa-Mir-199-P2-v3  Mdo-Mir-199-P2-v1  Mdo-Mir-199-P2-v2  Mdo-Mir-199-P2-v3  Mml-Mir-199-P2-v1  Mml-Mir-199-P2-v2  Mml-Mir-199-P2-v3  Mmu-Mir-199-P2-v1  Mmu-Mir-199-P2-v2  Mmu-Mir-199-P2-v3  Ocu-Mir-199-P2-v1  Ocu-Mir-199-P2-v2  Ocu-Mir-199-P2-v3  Sha-Mir-199-P2-v1  Sha-Mir-199-P2-v2  Sha-Mir-199-P2-v3  Xtr-Mir-199-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(chrPic1)
JH584417: 604979-605041 [+] UCSC
Clustered MiRNAs
(< 10kb from Mir-199-P2-v1)
Mir-199-P2-v2 JH584417: 604979-605041 [+] UCSC
Mir-199-P2-v3 JH584417: 604979-605041 [+] UCSC
Precursor
(pre-Mir +30nt flank)
GAGGUUUGAAACCGAUUCCAGCCCAGCCUGCCCAGUGUUCAGACUACCUGUUCAGGAGGCUAUCAAGGUGUACAGUAGUCUGCACAUUGGUUAGAUUGGGUUUGGUAAAGCAGCACCCAGGAG
Get precursor sequence
Structure
        10          20        30        40        50        60 
GAGGUUUGAAACCGAUU-  -|     GC   C       U        C   U AGGAGGC 
                  CC AGCCCA  CUG CCAGUGU CAGACUAC UGU C       U
                  GG UUGGGU  GAU GGUUACA GUCUGAUG ACA G       A
GAGGACCCACGACGAAAU  U^     UA   U       C        -   U UGGAACU 
 120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Te Te Te To
Star sequence

Cpi-Mir-199-P2-v1_5p*

MirBase accessionMIMAT0037818
Sequence
0- CCCAGUGUUCAGACUACCUGUUC -23
Get sequence
Mature sequence

Cpi-Mir-199-P2-v1_3p

MirBase accessionMIMAT0037819
Sequence
41- ACAGUAGUCUGCACAUUGGUUA -63
Get sequence
Seed sequenceCAGUAGU