MirGeneDB

MirGeneDB ID

Ete-Mir-199-P2-v3

Family name MIR-199 (all species)
Seed AGUAGUC
Species Lesser hedgehog tenrec (Echinops telfairi)
MiRBase ID
Paralogues Ete-Mir-199-P1-v1  Ete-Mir-199-P1-v2  Ete-Mir-199-P1-v3  Ete-Mir-199-P2-v1  Ete-Mir-199-P2-v2  Ete-Mir-199-P3-v1  Ete-Mir-199-P3-v2  Ete-Mir-199-P3-v3 
Orthologues Aca-Mir-199-P2-v1  Aca-Mir-199-P2-v2  Aca-Mir-199-P2-v3  Ami-Mir-199-P2-v1  Ami-Mir-199-P2-v2  Ami-Mir-199-P2-v3  Bta-Mir-199-P2-v1  Bta-Mir-199-P2-v2  Bta-Mir-199-P2-v3  Cfa-Mir-199-P2-v1  Cfa-Mir-199-P2-v2  Cfa-Mir-199-P2-v3  Cpi-Mir-199-P2-v1  Cpi-Mir-199-P2-v2  Cpi-Mir-199-P2-v3  Cpo-Mir-199-P2-v1  Cpo-Mir-199-P2-v2  Cpo-Mir-199-P2-v3  Dre-Mir-199-P2-v1  Dre-Mir-199-P2-v2  Dre-Mir-199-P2-v3  Hsa-Mir-199-P2-v1  Hsa-Mir-199-P2-v2  Hsa-Mir-199-P2-v3  Mdo-Mir-199-P2-v1  Mdo-Mir-199-P2-v2  Mdo-Mir-199-P2-v3  Mml-Mir-199-P2-v1  Mml-Mir-199-P2-v2  Mml-Mir-199-P2-v3  Mmu-Mir-199-P2-v1  Mmu-Mir-199-P2-v2  Mmu-Mir-199-P2-v3  Ocu-Mir-199-P2-v1  Ocu-Mir-199-P2-v2  Ocu-Mir-199-P2-v3  Sha-Mir-199-P2-v1  Sha-Mir-199-P2-v2  Sha-Mir-199-P2-v3  Xtr-Mir-199-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(echTel2)
JH980426: 1079700-1079760 [+] UCSC
Precursor
(pre-Mir +30nt flank)
GGGCCCCGGCCCGGACACCGGCCCCGCCGUCCCAGUGUUCAGACUACCUGUUCAGGGCUCUCGAUGUGUACAGUAGUCUGCACAUUGGUUAGGCGGGGCUGGGUGAGCAGCGCCCCUGGGG
Get precursor sequence
Structure
        10          20        30        40        50        60
GGGCCCCGGCCCGGACA--|          GUC       U        C   UCAGGGCU 
                   CCGGCCCCGCC   CCAGUGU CAGACUAC UGU        C
                   GGUCGGGGCGG   GGUUACA GUCUGAUG ACA        U
GGGGUCCCCGCGACGAGUG^          AUU       C        -   UGUGUAGC 
 .       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Ete-Mir-199-P2-v3_5p*

MirBase accessionNone
Sequence
0- CCCAGUGUUCAGACUACCUGUU -22
Get sequence
Mature sequence

Ete-Mir-199-P2-v3_3p

MirBase accessionNone
Sequence
40- CAGUAGUCUGCACAUUGGUUA -61
Get sequence