MirGeneDB

MirGeneDB ID

Bta-Mir-199-P2-v3

Family name MIR-199 (all species)
Seed AGUAGUC
Species Cow (Bos taurus)
MiRBase ID bta-mir-199a-2
Paralogues Bta-Mir-199-P1-v1  Bta-Mir-199-P1-v2  Bta-Mir-199-P1-v3  Bta-Mir-199-P2-v1  Bta-Mir-199-P2-v2  Bta-Mir-199-P3-v1  Bta-Mir-199-P3-v2  Bta-Mir-199-P3-v3 
Orthologues Aca-Mir-199-P2-v1  Aca-Mir-199-P2-v2  Aca-Mir-199-P2-v3  Ami-Mir-199-P2-v1  Ami-Mir-199-P2-v2  Ami-Mir-199-P2-v3  Cfa-Mir-199-P2-v1  Cfa-Mir-199-P2-v2  Cfa-Mir-199-P2-v3  Cpi-Mir-199-P2-v1  Cpi-Mir-199-P2-v2  Cpi-Mir-199-P2-v3  Cpo-Mir-199-P2-v1  Cpo-Mir-199-P2-v2  Cpo-Mir-199-P2-v3  Dre-Mir-199-P2-v1  Dre-Mir-199-P2-v2  Dre-Mir-199-P2-v3  Ete-Mir-199-P2-v1  Ete-Mir-199-P2-v2  Ete-Mir-199-P2-v3  Hsa-Mir-199-P2-v1  Hsa-Mir-199-P2-v2  Hsa-Mir-199-P2-v3  Mdo-Mir-199-P2-v1  Mdo-Mir-199-P2-v2  Mdo-Mir-199-P2-v3  Mml-Mir-199-P2-v1  Mml-Mir-199-P2-v2  Mml-Mir-199-P2-v3  Mmu-Mir-199-P2-v1  Mmu-Mir-199-P2-v2  Mmu-Mir-199-P2-v3  Ocu-Mir-199-P2-v1  Ocu-Mir-199-P2-v2  Ocu-Mir-199-P2-v3  Sha-Mir-199-P2-v1  Sha-Mir-199-P2-v2  Sha-Mir-199-P2-v3  Xtr-Mir-199-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(bosTau8)
chr7: 16508929-16508991 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-199-P2-v3)
Mir-199-P2-v1 chr7: 16508929-16508991 [-] UCSC Ensembl
Mir-199-P2-v2 chr7: 16508929-16508991 [-] UCSC Ensembl
Mir-199-P2-v3 chr7: 16508929-16508991 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
ACGGGAUGGAUGGACAGCCGGCCCCGCCAACCCAGUGUUCAGACUACCUGUUCAGGGGGCUCUGAAUGUGUACAGUAGUCUGCACAUUGGUUAGGCUGGGCUUGGGCAAGCGGCGCGUCGGGA
Get precursor sequence
Structure
        10          20        30        40        50        60 
ACGGGAUGGAUGGACAG-  -|    C   AAC       U        C   UCAGGGGGC 
                  CC GGCCC GCC   CCAGUGU CAGACUAC UGU         U
                  GG UCGGG CGG   GGUUACA GUCUGAUG ACA         C
AGGGCUGCGCGGCGAACG  U^    U   AUU       C        -   UGUGUAAGU 
 120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Star sequence

Bta-Mir-199-P2-v3_5p*

MirBase accessionMIMAT0003544
Sequence
0- CCCAGUGUUCAGACUACCUGUU -22
Get sequence
Validated targets TargetScanVert: bta-miR-199a-5p
Mature sequence

Bta-Mir-199-P2-v3_3p

MirBase accessionMIMAT0003746
Sequence
42- CAGUAGUCUGCACAUUGGUUA -63
Get sequence
Validated targets TargetScanVert: bta-miR-199a-3p