MirGeneDB

Gene name

Mmu-Mir-199-P3-v2

Family name MIR-199 (all species)
MiRBase ID mmu-mir-199b
Paralogues Mmu-Mir-199-P1-v1  Mmu-Mir-199-P1-v2  Mmu-Mir-199-P1-v3  Mmu-Mir-199-P2-v1  Mmu-Mir-199-P2-v2  Mmu-Mir-199-P2-v3  Mmu-Mir-199-P3-v1  Mmu-Mir-199-P3-v3 
Orthologues Aca-Mir-199-P3-v1  Aca-Mir-199-P3-v2  Aca-Mir-199-P3-v3  Ami-Mir-199-P3-v1  Ami-Mir-199-P3-v2  Ami-Mir-199-P3-v3  Bta-Mir-199-P3-v1  Bta-Mir-199-P3-v2  Bta-Mir-199-P3-v3  Cfa-Mir-199-P3-v1  Cfa-Mir-199-P3-v2  Cfa-Mir-199-P3-v3  Cli-Mir-199-P3-v1  Cli-Mir-199-P3-v2  Cli-Mir-199-P3-v3  Cpi-Mir-199-P3-v1  Cpi-Mir-199-P3-v2  Cpi-Mir-199-P3-v3  Cpo-Mir-199-P3-v1  Cpo-Mir-199-P3-v2  Cpo-Mir-199-P3-v3  Dno-Mir-199-P3-v1  Dno-Mir-199-P3-v2  Dno-Mir-199-P3-v3  Dre-Mir-199-P3-v1  Dre-Mir-199-P3-v2  Dre-Mir-199-P3-v3  Ete-Mir-199-P3-v1  Ete-Mir-199-P3-v2  Ete-Mir-199-P3-v3  Gga-Mir-199-P3-v1  Gga-Mir-199-P3-v2  Gga-Mir-199-P3-v3  Hsa-Mir-199-P3-v1  Hsa-Mir-199-P3-v2  Hsa-Mir-199-P3-v3  Mdo-Mir-199-P3-v1  Mdo-Mir-199-P3-v2  Mdo-Mir-199-P3-v3  Mml-Mir-199-P3-v1  Mml-Mir-199-P3-v2  Mml-Mir-199-P3-v3  Ocu-Mir-199-P3-v1  Ocu-Mir-199-P3-v2  Ocu-Mir-199-P3-v3  Rno-Mir-199-P3-v1  Rno-Mir-199-P3-v2  Rno-Mir-199-P3-v3  Sha-Mir-199-P3-v1  Sha-Mir-199-P3-v2  Sha-Mir-199-P3-v3  Tgu-Mir-199-P3-v1  Tgu-Mir-199-P3-v2  Tgu-Mir-199-P3-v3 
Node of Origin (gene) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(mm10)
chr2: 32318485-32318545 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-199-P3-v2)
Mir-199-P3-v1 chr2: 32318485-32318545 [+] UCSC Ensembl
Mir-199-P3-v3 chr2: 32318485-32318545 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AUGGACCAGAGGAUACCUCCACUCCGUCUACCCAGUGUUUAGACUACCUGUUCAGGACUCCCAAAUUGUACAGUAGUCUGCACAUUGGUUAGGCUGGGCUGGGUUAGACCCUCGGCACCGU
Get precursor sequence
Structure
        10         20         30        40        50        60
AUGGACCAGAGGAUACC-    CU  -|    C       U        C   U AGGACU 
                  UCCA  CC GUCUA CCAGUGU UAGACUAC UGU C      C
                  GGGU  GG CGGAU GGUUACA GUCUGAUG ACA G      C
UGCCACGGCUCCCAGAUU    CG  U^    U       C        -   U UUAAAC 
 .       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Star sequence

Mmu-Mir-199-P3-v2_5p*

MirBase accessionMIMAT0000672
Sequence
0- CCCAGUGUUUAGACUACCUGUUC -23
Get sequence
Validated targets microrna.org: MIMAT0000672
TargetScanVert: mmu-miR-199b-5p
miRDB: MIMAT0000672
Mature sequence

Mmu-Mir-199-P3-v2_3p

MirBase accessionMIMAT0004667
Sequence
38- UACAGUAGUCUGCACAUUGGUUA -61
Get sequence
Seed sequenceACAGUAG
Validated targets microrna.org: MIMAT0004667
TargetScanVert: mmu-miR-199b-3p
miRDB: MIMAT0004667