MirGeneDB

Gene name

Dre-Mir-181-P2b2

Family name MIR-181 (all species)
MiRBase ID dre-mir-181b-2
Paralogues Dre-Mir-181-P1a1  Dre-Mir-181-P1a2  Dre-Mir-181-P1b  Dre-Mir-181-P1c1  Dre-Mir-181-P1c2  Dre-Mir-181-P2a1  Dre-Mir-181-P2b1  Dre-Mir-181-P2c1  Dre-Mir-181-P2c2 
Orthologues Aca-Mir-181-P2b  Ami-Mir-181-P2b  Bta-Mir-181-P2b  Cfa-Mir-181-P2b  Cli-Mir-181-P2b  Cpi-Mir-181-P2b  Cpo-Mir-181-P2b  Dno-Mir-181-P2b  Ete-Mir-181-P2b  Gga-Mir-181-P2b  Hsa-Mir-181-P2b  Mdo-Mir-181-P2b  Mml-Mir-181-P2b  Mmu-Mir-181-P2b  Ocu-Mir-181-P2b  Rno-Mir-181-P2b  Sha-Mir-181-P2b  Tgu-Mir-181-P2b  Xtr-Mir-181-P2b 
Node of Origin (gene) Teleostei
Node of Origin (family) Vertebrata
Genome context
(danRer11_plustraces)
chr8: 53023694-53023753 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-181-P2b2)
Mir-181-P1b chr8: 53023545-53023607 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GGGUGUAUUAGCCCACUAAUGACUGCAAUAAACAUUCAUUGCUGUCGGUGGGUUUCUAAUAGACACAACUCACUGAUCAAUGAAUGCAAACUGCGGUGCAAGAACCUCAGUCUACAGAUU
Get precursor sequence
Structure
        10         20         30        40        50        60
GGGUGUAUUAGCCCACUAA-  -|     AUAAA         CU           UCUAA 
                    UG ACUGCA     CAUUCAUUG  GUCGGUGGGUU     U
                    AC UGGCGU     GUAAGUAAC  UAGUCACUCAA     A
UUAGACAUCUGACUCCAAGA  G^     CAAAC         --           CACAG 
.       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Mature sequence

Dre-Mir-181-P2b2_5p

MirBase accessionMIMAT0001270
Sequence
0- AACAUUCAUUGCUGUCGGUGGGUU -24
Get sequence
Seed sequenceACAUUCA
Star sequence

Dre-Mir-181-P2b2_3p*

MirBase accessionMIMAT0031920
Sequence
38- CUCACUGAUCAAUGAAUGCAAA -60
Get sequence