MirGeneDB

Gene name

Tgu-Mir-181-P2b

Family name MIR-181 (all species)
MiRBase ID tgu-mir-181b-2
Paralogues Tgu-Mir-181-P1a  Tgu-Mir-181-P1b  Tgu-Mir-181-P2a 
Orthologues Aca-Mir-181-P2b  Ami-Mir-181-P2b  Bta-Mir-181-P2b  Cfa-Mir-181-P2b  Cli-Mir-181-P2b  Cpi-Mir-181-P2b  Cpo-Mir-181-P2b  Dno-Mir-181-P2b  Dre-Mir-181-P2b1  Dre-Mir-181-P2b2  Ete-Mir-181-P2b  Gga-Mir-181-P2b  Hsa-Mir-181-P2b  Mdo-Mir-181-P2b  Mml-Mir-181-P2b  Mmu-Mir-181-P2b  Ocu-Mir-181-P2b  Rno-Mir-181-P2b  Sha-Mir-181-P2b  Xtr-Mir-181-P2b 
Node of Origin (gene) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(taeGut3.2.4)
17: 10713251-10713310 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-181-P2b)
Mir-181-P1b 17: 10712197-10712257 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UGGCAUCUCCAGCAUCUAAUGGCUGCAAUCAACAUUCAUUGCUGUCGGUGGGUUUUCAUUUCUAUCAACUCACUGACCAAUGAAUGCAAACUGCGGACCAGCCAGCCAAGGAGCACCCAC
Get precursor sequence
Structure
        10         20         30        40        50        60
UGGCAUCUCCAGCAUCUAA-   -|    AUCAA         CU           UUCAU 
                    UGG CUGCA     CAUUCAUUG  GUCGGUGGGUU     U
                    ACC GGCGU     GUAAGUAAC  CAGUCACUCAA     U
CACCCACGAGGAACCGACCG   A^    CAAAC         --           CUAUC 
.       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Fe Fe Fe Fe Ma Ma Ma Ma
Mature sequence

Tgu-Mir-181-P2b_5p

MirBase accessionMIMAT0014563
Sequence
0- AACAUUCAUUGCUGUCGGUGGGUU -24
Get sequence
Seed sequenceACAUUCA
Star sequence

Tgu-Mir-181-P2b_3p*

MirBase accessionMIMAT0031044
Sequence
38- CUCACUGACCAAUGAAUGCAAA -60
Get sequence