MirGeneDB

Gene name

Dno-Mir-181-P2b

Family name MIR-181 (all species)
MiRBase ID dno-mir-181b-2
Paralogues Dno-Mir-181-P1a  Dno-Mir-181-P1b  Dno-Mir-181-P1c  Dno-Mir-181-P2a  Dno-Mir-181-P2c 
Orthologues Aca-Mir-181-P2b  Ami-Mir-181-P2b  Bta-Mir-181-P2b  Cfa-Mir-181-P2b  Cli-Mir-181-P2b  Cpi-Mir-181-P2b  Cpo-Mir-181-P2b  Dre-Mir-181-P2b1  Dre-Mir-181-P2b2  Ete-Mir-181-P2b  Gga-Mir-181-P2b  Hsa-Mir-181-P2b  Mdo-Mir-181-P2b  Mml-Mir-181-P2b  Mmu-Mir-181-P2b  Ocu-Mir-181-P2b  Rno-Mir-181-P2b  Sha-Mir-181-P2b  Xtr-Mir-181-P2b 
Node of Origin (gene) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(dasNov3)
JH568938: 1611596-1611654 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-181-P2b)
Mir-181-P1b JH568938: 1612852-1612911 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CACCAACUAGAAACUUUGAUGGCUGCACUCAACAUUCAUUGCUGUCGGUGGGUUUGCAUCCGAAUCAACUCGCUGAUCAAUGAAUGCAAACUGCGGACCAAAAUACCCAAGGAAGCUAG
Get precursor sequence
Structure
        10        20         30        40        50        60
CACCAACUAGAAACUUUGA   -|    CUCAA         CU           UGCAU 
                   UGG CUGCA     CAUUCAUUG  GUCGGUGGGUU     C
                   ACC GGCGU     GUAAGUAAC  UAGUCGCUCAA     C
GAUCGAAGGAACCCAUAAA   A^    CAAAC         --           CUAAG 
       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsUG at 5p(-14)
Tissue expression
 +
To
Mature sequence

Dno-Mir-181-P2b_5p

MirBase accessionMIMAT0047692
Sequence
0- AACAUUCAUUGCUGUCGGUGGGUU -24
Get sequence
Seed sequenceACAUUCA
Star sequence

Dno-Mir-181-P2b_3p* (predicted)

MirBase accessionMIMAT0047694
Sequence
38- CUCGCUGAUCAAUGAAUGCAA -59
Get sequence