MirGeneDB

MirGeneDB ID

Gga-Mir-181-P2b

Family name MIR-181 (all species)
Seed ACAUUCA
Species Chicken (Gallus gallus)
MiRBase ID gga-mir-181b-2
Paralogues Gga-Mir-181-P1a  Gga-Mir-181-P1b  Gga-Mir-181-P2a 
Orthologues Aca-Mir-181-P2b  Ami-Mir-181-P2b  Bta-Mir-181-P2b  Cfa-Mir-181-P2b  Cli-Mir-181-P2b  Cpi-Mir-181-P2b  Cpo-Mir-181-P2b  Dno-Mir-181-P2b  Dre-Mir-181-P2b1  Dre-Mir-181-P2b2  Ete-Mir-181-P2b  Hsa-Mir-181-P2b  Mdo-Mir-181-P2b  Mml-Mir-181-P2b  Mmu-Mir-181-P2b  Oan-Mir-181-P2b  Ocu-Mir-181-P2b  Rno-Mir-181-P2b  Sha-Mir-181-P2b  Sto-Mir-181-P2b  Tgu-Mir-181-P2b  Xtr-Mir-181-P2b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(galGal5)
17: 9983787-9983846 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-181-P2b)
Mir-181-P1b 17: 9982155-9982215 [+] UCSC Ensembl
Mir-181-P2b 17: 9983787-9983846 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCUCCGGCCCAGCAUCUAAUGGCUGCAAUCAACAUUCAUUGCUGUCGGUGGGUUUUCAUUGCUAUCAACUCACUGAUCAAUGAAUGCAAACUGCGGACCAGCUGGCUAAGAGGCUGCGUG
Get precursor sequence
Structure
        10         20         30        40        50        60
GCUCCGGCCCAGCAUCUAA-   -|    AUCAA         CU           UUCAU 
                    UGG CUGCA     CAUUCAUUG  GUCGGUGGGUU     U
                    ACC GGCGU     GUAAGUAAC  UAGUCACUCAA     G
GUGCGUCGGAGAAUCGGUCG   A^    CAAAC         --           CUAUC 
.       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Ad Ad Ad Br Br Ce Ce Ce Ce Ch He He Hy Hy Ki Ki Li Li Lu Lu Ov Pr Pr Sc Sc Sp Sp Te
Mature sequence

Gga-Mir-181-P2b_5p

MirBase accessionMIMAT0001151
Sequence
0- AACAUUCAUUGCUGUCGGUGGGUU -24
Get sequence
Validated targets TargetScanVert: gga-miR-181b-5p
miRDB: MIMAT0001151
Star sequence

Gga-Mir-181-P2b_3p*

MirBase accessionMIMAT0031059
Sequence
38- CUCACUGAUCAAUGAAUGCAAA -60
Get sequence
Validated targets TargetScanVert: gga-miR-181b-2-3p
miRDB: MIMAT0031059