MirGeneDB

MirGeneDB ID

Asu-Mir-5350-P6

Family name MIR-5350 (all species)
Seed CGGGUAU
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-5354
Paralogues Asu-Mir-5350-P1  Asu-Mir-5350-P2  Asu-Mir-5350-P3  Asu-Mir-5350-P4  Asu-Mir-5350-P5 
Orthologues
Node of Origin (locus) A. suum
Node of Origin (family) A. suum
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold800: 97547-97610 [-]
Clustered MiRNAs
(< 10kb from Mir-5350-P6)
Mir-5350-P6 Scaffold800: 97547-97610 [-]
Mir-279-o26 Scaffold800: 97897-97956 [-]
Mir-2-o61 Scaffold800: 98049-98111 [-]
Mir-36-o28 Scaffold800: 98613-98672 [-]
Precursor
(pre-Mir +30nt flank)
UGCAUAGGAGCUGCGUAUCGCUUCAACCGAGCGGGUAUGGUUGUGUUCCAAAGCCGGUAGUGAUAGCGACACUUUGGCACAAUCACACCUGCUCAGGCGGAAUUGCUUAGUGCAGUGUUCAUUG
Get precursor sequence
Structure
        10        20           30        40        50        60  
UGCAUAGGAGCUGCGUAUC  --   AA  -|       A        UU      CCGGUAGU 
                   GC  UUC  CC GAGCGGGU UGGUUGUG  CCAAAG        G
                   CG  AAG  GG CUCGUCCA ACUAACAC  GGUUUC        A
GUUACUUGUGACGUGAUU-  UU   GC  A^       C        --      ACAGCGAU 
  120       110        100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Mature sequence

Asu-Mir-5350-P6_5p

MirBase accessionMIMAT0021568
Sequence
0- GCGGGUAUGGUUGUGUUCCAAAGC -24
Get sequence
Co-mature sequence

Asu-Mir-5350-P6_3p

MirBase accessionMIMAT0021569
Sequence
42- UUUGGCACAAUCACACCUGCUC -64
Get sequence