MirGeneDB

MirGeneDB ID

Asu-Mir-5350-P4

Family name MIR-5350 (all species)
Seed UUGGCAC
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-5350d
Paralogues Asu-Mir-5350-P1  Asu-Mir-5350-P2  Asu-Mir-5350-P3  Asu-Mir-5350-P5  Asu-Mir-5350-P6 
Orthologues
Node of Origin (locus) A. suum
Node of Origin (family) A. suum
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold123: 289536-289593 [-]
Clustered MiRNAs
(< 10kb from Mir-5350-P4)
Mir-5350-P4 Scaffold123: 289536-289593 [-]
Mir-36-o32 Scaffold123: 289846-289901 [-]
Precursor
(pre-Mir +30nt flank)
CUGCUCAUGCAAUACGGCUGCUGUCGGCGGCCUUUCUCGGGUAAGCUAAAUUGUUUUUGUGCGAAAUUUGGCACGCCCGUGGAAUGCCCAUUGCAGUAUGCCAGUAAUCCUUGUAUUG
Get precursor sequence
Structure
        10          20        30        40        50        
CUGCUCAUGCAAUACGGC--|     CGGC   C    U     AA        GUUUU 
                    UGCUGU    GGC UUUC CGGGU  GCUAAAUU     U
                    AUGACG    CCG AAGG GCCCG  CGGUUUAA     G
GUUAUGUUCCUAAUGACCGU^     UUAC   U    U     CA        AGCGU 
      110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Star sequence

Asu-Mir-5350-P4_5p*

MirBase accessionMIMAT0021558
Sequence
0- CCUUUCUCGGGUAAGCUAAAUU -22
Get sequence
Mature sequence

Asu-Mir-5350-P4_3p

MirBase accessionMIMAT0021559
Sequence
36- UUUGGCACGCCCGUGGAAUGCC -58
Get sequence