MirGeneDB

MirGeneDB ID

Asu-Mir-5350-P1

Family name MIR-5350 (all species)
Seed UUGGCAC
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-5350a
Paralogues Asu-Mir-5350-P2  Asu-Mir-5350-P3  Asu-Mir-5350-P4  Asu-Mir-5350-P5  Asu-Mir-5350-P6 
Orthologues
Node of Origin (locus) A. suum
Node of Origin (family) A. suum
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold730: 214863-214919 [+]
Clustered MiRNAs
(< 10kb from Mir-5350-P1)
Mir-5350-P1 Scaffold730: 214863-214919 [+]
Mir-36-o30 Scaffold730: 215044-215101 [+]
Precursor
(pre-Mir +30nt flank)
UUGUUCUUCGAAGGACAGGGCCGCCGGAGGAGUUUCUCAGGACUGCUAAAUUGUGAAUCGGCUAAUUUGGCACGCCUGAAAAACUACUCUUGUAGGUCCUCAGACGUAAAGCUCAGU
Get precursor sequence
Structure
        10         20         30        40        50        
UUGUUCUUCGAAGGACA-     -| C    G     C     AC         GUGAA 
                  GGGCC GC GGAG AGUUU UCAGG  UGCUAAAUU     \
                  CCUGG UG UCUC UCAAA AGUCC  ACGGUUUAA     U
UGACUCGAAAUGCAGACU     A^ U    A     A     GC         UCGGC 
     110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Star sequence

Asu-Mir-5350-P1_5p*

MirBase accessionMIMAT0021552
Sequence
0- AGUUUCUCAGGACUGCUAAAUU -22
Get sequence
Mature sequence

Asu-Mir-5350-P1_3p

MirBase accessionMIMAT0021553
Sequence
35- UUUGGCACGCCUGAAAAACUAC -57
Get sequence