MirGeneDB

MirGeneDB ID

Asu-Mir-5350-P5

Family name MIR-5350 (all species)
Seed UUGGCAC
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-5351
Paralogues Asu-Mir-5350-P1  Asu-Mir-5350-P2  Asu-Mir-5350-P3  Asu-Mir-5350-P4  Asu-Mir-5350-P6 
Orthologues
Node of Origin (locus) A. suum
Node of Origin (family) A. suum
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold95: 1540197-1540253 [+]
Precursor
(pre-Mir +30nt flank)
UUAUUGCGAAGCUGAAGAAGCGUACCAAGUCAGGUUUUACUAAUGACCAAAUUGUUUCAAGCGAAUUUGGCACAUGUAAUACCUGCCUUGGUUGCUACUUACCUUGCUUCACAACAA
Get precursor sequence
Structure
        10           20        30        40        50        
UUAUUGCGAAGCUGAAGA---|   U      U     U    UAA  A       GUUU 
                     AGCG ACCAAG CAGGU UUAC   UG CCAAAUU    C
                     UCGU UGGUUC GUCCA AAUG   AC GGUUUAA    A
AACAACACUUCGUUCCAUUCA^   -      C     U    UAC  -       GCGA 
     110       100         90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Star sequence

Asu-Mir-5350-P5_5p*

MirBase accessionMIMAT0021560
Sequence
0- CAGGUUUUACUAAUGACCAAAUU -23
Get sequence
Mature sequence

Asu-Mir-5350-P5_3p

MirBase accessionMIMAT0021561
Sequence
35- UUUGGCACAUGUAAUACCUGCC -57
Get sequence