MirGeneDB

MirGeneDB ID

Asu-Mir-5350-P3

Family name MIR-5350 (all species)
Seed UUGGCAC
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-5350c
Paralogues Asu-Mir-5350-P1  Asu-Mir-5350-P2  Asu-Mir-5350-P4  Asu-Mir-5350-P5  Asu-Mir-5350-P6 
Orthologues
Node of Origin (locus) A. suum
Node of Origin (family) A. suum
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold1190: 38272-38328 [-]
Clustered MiRNAs
(< 10kb from Mir-5350-P3)
Mir-5350-P3 Scaffold1190: 38272-38328 [-]
Mir-5350-P2 Scaffold1190: 38567-38623 [-]
Precursor
(pre-Mir +30nt flank)
UUUGCCCAUCAGUGAUAACGCUGGAGGUGGCGUUUCUGAGGUCCGCCAAAUUGCUUUACGACAAACUUGGCACACCUGAGAAACGCCUGCUCCAGUUGCCUAUAUGCUAAAUGUUCA
Get precursor sequence
Structure
        10          20        30        40        50        
UUUGCCCAUCAGUGAUAAC--|      GU         G    CC     A  GCUUU 
                     GCUGGAG  GGCGUUUCU AGGU  GCCAA UU     \
                     UGACCUC  CCGCAAAGA UCCA  CGGUU AA     A
ACUUGUAAAUCGUAUAUCCGU^      GU         G    CA     C  ACAGC 
     110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Star sequence

Asu-Mir-5350-P3_5p* (predicted)

MirBase accessionMIMAT0021556
Sequence
0- CGUUUCUGAGGUCCGCCAAAUU -22
Get sequence
Mature sequence

Asu-Mir-5350-P3_3p

MirBase accessionMIMAT0021557
Sequence
35- CUUGGCACACCUGAGAAACGCC -57
Get sequence