MirGeneDB

MirGeneDB ID

Asu-Mir-36-o28

Family name MIR-36 (all species)
Seed CACCGGG
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-36b
Paralogues Asu-Mir-36-o27  Asu-Mir-36-o29-v1  Asu-Mir-36-o29-v2  Asu-Mir-36-o30  Asu-Mir-36-o31  Asu-Mir-36-o32 
Orthologues Bge-Mir-36  Cgi-Mir-36  Cte-Mir-36  Dpu-Mir-36  Tca-Mir-36 
Node of Origin (locus) A. suum
Node of Origin (family) Protostomia
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold800: 98613-98672 [-]
Clustered MiRNAs
(< 10kb from Mir-36-o28)
Mir-5350-P6 Scaffold800: 97547-97610 [-]
Mir-279-o26 Scaffold800: 97897-97956 [-]
Mir-2-o61 Scaffold800: 98049-98111 [-]
Mir-36-o28 Scaffold800: 98613-98672 [-]
Precursor
(pre-Mir +30nt flank)
GCUUGUUGCUGUGCUUUCAAUGUGGCCGAUCGUGAGUGUUUGCGACGGUUAGCGUCUGGUAUCGGUGCUCACCGGGUGAACAUUCAUUAUCGGCCCAUUGGCUUUGCUGGCUAAUAGCUG
Get precursor sequence
Structure
        10           20        30        40        50          
GCUUGUUGCUGUGCUUU---|    U       C         UG GA    U   GUCUGG 
                    CAAUG GGCCGAU GUGAGUGUU  C  CGGU AGC      \
                    GUUAC CCGGCUA UACUUACAA  G  GCCA UCG      U
GUCGAUAAUCGGUCGUUUCG^    -       U         GU G-    C   UGGCUA 
.       110       100         90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Star sequence

Asu-Mir-36-o28_5p*

MirBase accessionMIMAT0021441
Sequence
0- CGUGAGUGUUUGCGACGGUUAGC -23
Get sequence
Mature sequence

Asu-Mir-36-o28_3p

MirBase accessionMIMAT0021442
Sequence
38- UCACCGGGUGAACAUUCAUUAU -60
Get sequence