MirGeneDB

MirGeneDB ID

Asu-Mir-279-o26

Family name MIR-279 (all species)
Seed GACUAGA
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-44a
Paralogues Asu-Mir-279-o27  Asu-Mir-279-o28  Asu-Mir-279-o29  Asu-Mir-279-o30 
Orthologues Aae-Mir-279-o26  Cgi-Mir-279  Isc-Mir-279  Lgi-Mir-279 
Node of Origin (locus) A. suum
Node of Origin (family) Protostomia
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold800: 97897-97956 [-]
Clustered MiRNAs
(< 10kb from Mir-279-o26)
Mir-5350-P6 Scaffold800: 97547-97610 [-]
Mir-279-o26 Scaffold800: 97897-97956 [-]
Mir-2-o61 Scaffold800: 98049-98111 [-]
Mir-36-o28 Scaffold800: 98613-98672 [-]
Precursor
(pre-Mir +30nt flank)
UCUACGUGUCGAAGACGCCCAGACGUGAAACUGGAUGUCUCUCGCAGUCAUACGGUAUAUAGAGUUCUAUGACUAGAGACACAUUCAGCUUGGCGGCUGGACGACAACCCUCACAAGUCA
Get precursor sequence
Structure
        10          20        30        40        50          
UCUACGUGUCGAAGACGC--|   A   G  A        C    GC       CGGUAUA 
                    CCAG CGU AA CUGGAUGU UCUC  AGUCAUA       \
                    GGUC GCG UU GACUUACA AGAG  UCAGUAU       U
ACUGAACACUCCCAACAGCA^   G   G  C        C    A-       CUUGAGA 
.       110       100        90        80         70
Deep sequencing
Go to detailed chart
CommentIt is not clear either from phylogenetic or syntenic information how many Mir-279 genes were present in the last common ancestor of protostomes and how the Drosophila Mir-279s relate to the other invertebrate Mir-279s and thus these multiple paralogues in invertebrates are classified here as orphans pending new data.
3' NTU No
MotifsNo
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Star sequence

Asu-Mir-279-o26_5p*

MirBase accessionMIMAT0021455
Sequence
0- CUGGAUGUCUCUCGCAGUCAUA -22
Get sequence
Mature sequence

Asu-Mir-279-o26_3p

MirBase accessionMIMAT0021456
Sequence
39- UGACUAGAGACACAUUCAGCU -60
Get sequence