MirGeneDB

MirGeneDB ID

Asu-Mir-10-P4

Family name MIR-10 (all species)
Seed AAGCUCG
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-993
Paralogues Asu-Mir-10-P1  Asu-Mir-10-P2o1  Asu-Mir-10-P2o2  Asu-Mir-10-P2o3  Asu-Mir-10-P2o4  Asu-Mir-10-P2o5  Asu-Mir-10-P2o6  Asu-Mir-10-P3 
Orthologues Aae-Mir-10-P4  Bge-Mir-10-P4  Cte-Mir-10-P4  Dan-Mir-10-P4  Dme-Mir-10-P4  Dmo-Mir-10-P4  Dpu-Mir-10-P4  Efe-Mir-10-P4a  Efe-Mir-10-P4b  Efe-Mir-10-P4c  Hme-Mir-10-P4  Isc-Mir-10-P4  Lan-Mir-10-P4a  Lan-Mir-10-P4b  Tca-Mir-10-P4 
Node of Origin (locus) Protostomia
Node of Origin (family) Eumetazoa
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold426: 156003-156060 [+]
Precursor
(pre-Mir +30nt flank)
CUAUGCACUAUUCAAUCGUCCGGAUGGUUUACCCUGUAGAAGCGUGUUUAUCUGCACAUUUCAAAAUAAGCUCGUCUCUACAGGCAGGACCUUCCAGGCUUCUAUGACCAAUCGGACA
Get precursor sequence
Structure
        10          20        30        40        50        
CUAUGCACUAUUCAAUC--|  C   U     AC        AG  U      CUGCAC 
                   GUC GGA GGUUU  CCUGUAGA  CG GUUUAU      A
                   CGG CCU CCAGG  GGACAUCU  GC CGAAUA      U
ACAGGCUAACCAGUAUCUU^  A   U     AC        CU  U      AAACUU 
      110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Star sequence

Asu-Mir-10-P4_5p*

MirBase accessionMIMAT0021531
Sequence
0- ACCCUGUAGAAGCGUGUUUAUC -22
Get sequence
Mature sequence

Asu-Mir-10-P4_3p

MirBase accessionMIMAT0021532
Sequence
36- UAAGCUCGUCUCUACAGGCAGG -58
Get sequence