MirGeneDB

MirGeneDB ID

Asu-Mir-10-P2o5

Family name MIR-10 (all species)
Seed ACCCGUA
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-100d
Paralogues Asu-Mir-10-P1  Asu-Mir-10-P2o1  Asu-Mir-10-P2o2  Asu-Mir-10-P2o3  Asu-Mir-10-P2o4  Asu-Mir-10-P2o6  Asu-Mir-10-P3  Asu-Mir-10-P4 
Orthologues Aae-Mir-10-P2  Bfl-Mir-10-P2-v1  Bfl-Mir-10-P2-v2  Bge-Mir-10-P2  Cgi-Mir-10-P2  Cin-Mir-10-P2  Cte-Mir-10-P2  Dan-Mir-10-P2  Dme-Mir-10-P2  Dmo-Mir-10-P2  Dpu-Mir-10-P2  Isc-Mir-10-P2  Lan-Mir-10-P2  Lgi-Mir-10-P2  Pfl-Mir-10-P2  Pmi-Mir-10-P2  Sko-Mir-10-P2  Tca-Mir-10-P2 
Node of Origin (locus) A. suum
Node of Origin (family) Eumetazoa
Genome context
(ASU_PRJNA80881_plustraces)
C4124442: 39-95 [-]
Precursor
(pre-Mir +30nt flank)
UGUGUGUGUGAGCAGGGAUGAUGGGCGGUGAACCCGUAUGCUGUUGGGUGUGUUGGGUUCGGUGACACGCUACGGUGUUCGGGUCCACCGAGGCGUCCAAGCUCGUCUACAGUUUGC
Get precursor sequence
Structure
        10         20         30        40        50         
UGUGUGUGUGAGCAGGGAU-    GG-|    A     U       UG       UGGGU 
                    GAUG   CGGUG ACCCG AUGCUGU  GGUGUGU     \
                    CUGC   GCCAC UGGGC UGUGGCA  UCGCACA     U
CGUUUGACAUCUGCUCGAAC    GGA^    C     U       --       GUGGC 
     110       100        90        80          70        60
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsCNNC at 3p(+17)
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Mature sequence

Asu-Mir-10-P2o5_5p

MirBase accessionMIMAT0021493
Sequence
0- AACCCGUAUGCUGUUGGGUGUGU -23
Get sequence
Star sequence

Asu-Mir-10-P2o5_3p* (predicted)

MirBase accessionMIMAT0021494
Sequence
35- CACGCUACGGUGUUCGGGUCCA -57
Get sequence