
MirGeneDB ID


Family name MIR-10 (all species)
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-100c
Paralogues Asu-Mir-10-P1  Asu-Mir-10-P2o1  Asu-Mir-10-P2o2  Asu-Mir-10-P2o3  Asu-Mir-10-P2o5  Asu-Mir-10-P2o6  Asu-Mir-10-P3  Asu-Mir-10-P4 
Orthologues Aae-Mir-10-P2  Bfl-Mir-10-P2-v1  Bfl-Mir-10-P2-v2  Bge-Mir-10-P2  Cgi-Mir-10-P2  Cin-Mir-10-P2  Cte-Mir-10-P2  Dan-Mir-10-P2  Dme-Mir-10-P2  Dmo-Mir-10-P2  Dpu-Mir-10-P2  Isc-Mir-10-P2  Lan-Mir-10-P2  Lgi-Mir-10-P2  Pfl-Mir-10-P2  Pmi-Mir-10-P2  Sko-Mir-10-P2  Tca-Mir-10-P2 
Node of Origin (locus) A. suum
Node of Origin (family) Eumetazoa
Genome context
Scaffold883: 121212-121269 [+]
Clustered MiRNAs
(< 10kb from Mir-10-P2o4)
Mir-10-P2o4 Scaffold883: 121212-121269 [+]
Mir-10-P2o1 Scaffold883: 122323-122381 [+]
(pre-Mir +30nt flank)
Get precursor sequence
        10        20          30        40        50         
UUGGUGGUGGCAUUUAGCCG--|       U       U   UC     U     CAGCA 
                      GUGUGCGG GUACCCG AGC  CGAAA CGUGU     U
                      UACGCGUC CGUGGGC UCG  GCUUU GCACA     U
UCCGUCGAGUCUGGGGCCUUUA^       C       -   UU     -     UAAGU 
      110       100        90         80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
Tissue expression
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Mature sequence


MirBase accessionMIMAT0021491
Get sequence
Star sequence


MirBase accessionMIMAT0021492
Get sequence