MirGeneDB

MirGeneDB ID

Asu-Mir-10-P2o6

Family name MIR-10 (all species)
Seed ACCUGAG
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-100e
Paralogues Asu-Mir-10-P1  Asu-Mir-10-P2o1  Asu-Mir-10-P2o2  Asu-Mir-10-P2o3  Asu-Mir-10-P2o4  Asu-Mir-10-P2o5  Asu-Mir-10-P3  Asu-Mir-10-P4 
Orthologues Aae-Mir-10-P2  Bfl-Mir-10-P2-v1  Bfl-Mir-10-P2-v2  Bge-Mir-10-P2  Cgi-Mir-10-P2  Cin-Mir-10-P2  Cte-Mir-10-P2  Dan-Mir-10-P2  Dme-Mir-10-P2  Dmo-Mir-10-P2  Dpu-Mir-10-P2  Isc-Mir-10-P2  Lan-Mir-10-P2  Lgi-Mir-10-P2  Pfl-Mir-10-P2  Pmi-Mir-10-P2  Sko-Mir-10-P2  Tca-Mir-10-P2 
Node of Origin (locus) A. suum
Node of Origin (family) Eumetazoa
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold68: 233217-233273 [-]
Clustered MiRNAs
(< 10kb from Mir-10-P2o6)
Mir-10-P2o6 Scaffold68: 233217-233273 [-]
Mir-5345 Scaffold68: 235543-235601 [+]
Precursor
(pre-Mir +30nt flank)
UUGUUUGUCUGGAUUGUGGUGUGUGCGGUGAACCUGAGGACCGUAUGCUGUGUUUGGAUAGGUAACACGCAACGGUGUUCGGGUCCACUAAAGCAUCCAAACUCAUCCUCGACCGUA
Get precursor sequence
Structure
        10          20         30        40        50         
UUGUUUGUCUGGAUUGU--| U    GC-    A       G     A   U     UGGA 
                   GG GUGU   GGUG ACCUGAG ACCGU UGC GUGUU    \
                   CC UACG   UCAC UGGGCUU UGGCA ACG CACAA    U
AUGCCAGCUCCUACUCAAA^ -    AAA    C       G     -   -     UGGA 
     110       100         90        80         70         60
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Mature sequence

Asu-Mir-10-P2o6_5p

MirBase accessionMIMAT0021542
Sequence
0- AACCUGAGGACCGUAUGCUGUGUU -24
Get sequence
Star sequence

Asu-Mir-10-P2o6_3p* (predicted)

MirBase accessionMIMAT0021543
Sequence
35- CACGCAACGGUGUUCGGGUCCA -57
Get sequence