MirGeneDB ID | War-Mir-87-o29 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Family name | MIR-87 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Species | Wirenia (Solenogaster) (Wirenia argentea) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Paralogues | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Orthologues | Agr-Mir-87-o29 Eba-Mir-87-o29 Gsp-Mir-87 Mom-Mir-87-o29 Sne-Mir-87 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (locus) | Aculifera | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (family) | Protostomia | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genome context (GCA_025802215.1_ASM2580221v1_Wirenia) |
WNLI01038430.1: 816-873 [-] Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Seed | UGAGCAA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Precursor (pre-Mir +30nt flank) |
GAAAUGUCACAGAAAUAUCCGUGUCACAUGUGCCUGAAAUUUUGUCUCAAGCCUGUGAUUAAUUAAGGUGAGCAAAGUUUCAGGUGUGUGGGAUGCGGUAUCGAUCAUCACACUUGGUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Structure | 10 20 30 40 50 GAAAUGUCACAGAAAUAU--| A UG U AA GUGAU CCGUGUC CAUG CCUGAAAUUUUG CUC GCCU \ GGCGUAG GUGU GGACUUUGAAAC GAG UGGA U UGGUUCACACUACUAGCUAU^ G GU - -- AUUAA 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Comment | It is unclear if this is Mir-87-P1 or P2 given that one of the paralogues was lost in this group and there are no sequence signatures to recognize one paralogue from the other. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Motifs | CNNC at 3p(+17), UGUG in loop | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Star sequence | War-Mir-87-o29_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
0- UGCCUGAAAUUUUGUCUCAAGCCU -24
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mature sequence | War-Mir-87-o29_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
37- GUGAGCAAAGUUUCAGGUGUG -58
Get sequence
|