MirGeneDB ID | Mom-Mir-87-o29 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Family name | MIR-87 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Species | Mossy chiton (Mopalia muscosa) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Paralogues | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Orthologues | Agr-Mir-87-o29 Eba-Mir-87-o29 Gsp-Mir-87 Sne-Mir-87 War-Mir-87-o29 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (locus) | Aculifera | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (family) | Protostomia | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genome context (GCA_031763545.1_ASM3176354v1_genomic_Mom) |
JARFOD010087928.1: 5453-5513 [-] Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Seed | UGAGCAA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Precursor (pre-Mir +30nt flank) |
UGUUUCCUGAGAAAAAAUUGUUUGUUUGCUGCGCCUGACACUUUGUCUCAAACCUGUGAUUAAAAAAAGGUGAGCAAAGUUUCAGGUGUAUUGAACCUGCAAACUGGACAUCUUCAUUUUCGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Structure | 10 20 30 40 50 60 UGUUUCCUGAGAAAAAA--| UU GC C U AA GUGAU UUGU GUUU UGCGCCUGA ACUUUG CUC ACCU U AACG CAAG AUGUGGACU UGAAAC GAG UGGA A CUUUUACUUCUACAGGUCA^ UC UU U - -- AAAAA . 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Comment | It is unclear if this is Mir-87-P1 or P2 given that one of the paralogues was lost in this group and there are no sequence signatures to recognize one paralogue from the other. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Motifs | CNNC at 3p(+17), UGUG in loop | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Star sequence | Mom-Mir-87-o29_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
0- GCGCCUGACACUUUGUCUCAAACCU -25
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mature sequence | Mom-Mir-87-o29_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
39- GUGAGCAAAGUUUCAGGUGUAU -61
Get sequence
|