MirGeneDB

MirGeneDB ID

Sto-Mir-338-P1

Family name MIR-338 (all species)
Seed CCAGCAU
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-338-P2 
Orthologues Aca-Mir-338-P1  Ami-Mir-338-P1  Bta-Mir-338-P1  Bta-Mir-338-P1-as  Cfa-Mir-338-P1  Cfa-Mir-338-P1-as  Cli-Mir-338-P1  Cpi-Mir-338-P1  Cpi-Mir-338-P1-as  Cpo-Mir-338-P1  Dno-Mir-338-P1  Dre-Mir-338-P1a  Dre-Mir-338-P1b  Ete-Mir-338-P1  Ete-Mir-338-P1-as  Gga-Mir-338-P1  Hsa-Mir-338-P1  Hsa-Mir-338-P1-as  Mdo-Mir-338-P1  Mml-Mir-338-P1  Mml-Mir-338-P1-as  Mmu-Mir-338-P1  Mmu-Mir-338-P1-as  Oan-Mir-338-P1  Rno-Mir-338-P1  Rno-Mir-338-P1-as  Sha-Mir-338-P1  Tgu-Mir-338-P1  Tgu-Mir-338-P1-as  Xtr-Mir-338-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(miRNA_loci_genome)
BFAA01011895.1: 45596-45655 [+]
Precursor
(pre-Mir +30nt flank)
CGGAGACCGUCGUCGCUGUUCAUUCCCUGCAACAAUAUCCUGAUGCUGACAGAGUGAACCUGGCGACUCCAGCAUCAGUGAUUUUGUUGCGGAGGGUGAUCACUCACUGCUUUGCAAUGG
Get precursor sequence
Structure
        10          20        30         40        50        60
CGGAGACCGUCGUCGCU-- U      C         U   -|        ACA    GAAC 
                   G UCAUUC CUGCAACAA AUC CUGAUGCUG   GAGU    C
                   C AGUGGG GGCGUUGUU UAG GACUACGAC   CUCA    U
GGUAACGUUUCGUCACUCA U      A         U   U^        ---    GCGG 
.       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Sto-Mir-338-P1_5p* (predicted)

MirBase accessionNone
Sequence
0- AACAAUAUCCUGAUGCUGACAGAGU -25
Get sequence
Mature sequence

Sto-Mir-338-P1_3p

MirBase accessionNone
Sequence
37- UCCAGCAUCAGUGAUUUUGUUGC -60
Get sequence