MirGeneDB

MirGeneDB ID

Sto-Mir-19-P2b

Family name MIR-19 (all species)
Seed GUGCAAA
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-19-P1  Sto-Mir-19-P2a  Sto-Mir-19-P2d 
Orthologues Aca-Mir-19-P2b  Bta-Mir-19-P2b  Cfa-Mir-19-P2b  Cli-Mir-19-P2b  Cpi-Mir-19-P2b  Cpo-Mir-19-P2b  Dno-Mir-19-P2b  Dre-Mir-19-P2b1  Ete-Mir-19-P2b  Gga-Mir-19-P2b  Hsa-Mir-19-P2b  Mdo-Mir-19-P2b  Mml-Mir-19-P2b  Mmu-Mir-19-P2b  Oan-Mir-19-P2b  Ocu-Mir-19-P2b  Rno-Mir-19-P2b  Sha-Mir-19-P2b  Tgu-Mir-19-P2b  Xtr-Mir-19-P2b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(miRNA_loci_genome)
BFAA01013767.1: 5089-5150 [+]
Precursor
(pre-Mir +30nt flank)
GGAAAUCUUCAUGAGGUACUGUUAACAGUUAGUUUUGCAGGUUUGCAUUCAGCUGAUAUGUGCUGAUGCUGUGCAAAUCCAUGCAAAACUGACAGUAGCAGUGGUUUCUAGAGAAUUGAAUG
Get precursor sequence
Structure
        10           20        30         40         50        60
GGAAAUCUUCAUGAGGU---       ACA            -  -|     UU    UGAUAU 
                    ACUGUUA   GUUAGUUUUGCA GG UUUGCA  CAGC      G
                    UGACGAU   CAGUCAAAACGU CC AAACGU  GUCG      U
GUAAGUUAAGAGAUCUUUGG       GA-            A  U^     --    UAGUCG 
120       110       100         90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
To
Star sequence

Sto-Mir-19-P2b_5p* (predicted)

MirBase accessionNone
Sequence
0- AGUUUUGCAGGUUUGCAUUCAGC -23
Get sequence
Mature sequence

Sto-Mir-19-P2b_3p

MirBase accessionNone
Sequence
39- UGUGCAAAUCCAUGCAAAACUGA -62
Get sequence