MirGeneDB

MirGeneDB ID

Rno-Mir-384

Family name MIR-384 (all species)
Seed UUCCUAG
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-384
Paralogues
Orthologues Cfa-Mir-384  Mmu-Mir-384  Ocu-Mir-384 
Node of Origin (locus) Eutheria
Node of Origin (family) Eutheria
Genome context
(rn6)
chrX: 76301773-76301835 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUUGUUGCAGCGAAAUGUUAAAUCAGGAAUUGUAAACAAUUCCUAGGCAAUGUGUAUAAUGUUGGUAAGUCAUUCCUAGAAAUUGUUCACAAUGCCUGUAACAUAUAUGCAGCUAGCAAGAUU
Get precursor sequence
Structure
        10        20          30        40        50        60 
UUUGUUGCAGCGAAAUGUUAAAU--|   A     A       C     C    UGUAUAAU 
                         CAGG AUUGU AACAAUU CUAGG AAUG        G
                         GUCC UAACA UUGUUAA GAUCC UUAC        U
UUAGAACGAUCGACGUAUAUACAAU^   G     C       A     -    UGAAUGGU 
 120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Star sequence

Rno-Mir-384_5p*

MirBase accessionMIMAT0005309
Sequence
0- UGUAAACAAUUCCUAGGCAAUGU -23
Get sequence
Validated targets microrna.org: MIMAT0005309
TargetScanVert: rno-miR-384-5p
miRDB: MIMAT0005309
Mature sequence

Rno-Mir-384_3p

MirBase accessionMIMAT0005310
Sequence
41- AUUCCUAGAAAUUGUUCACAAU -63
Get sequence
Validated targets microrna.org: MIMAT0005310
TargetScanVert: rno-miR-384-3p
miRDB: MIMAT0005310