MirGeneDB

MirGeneDB ID

Rno-Mir-374-P2

Family name MIR-374 (all species)
Seed UAUAAUA
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-374
Paralogues
Orthologues Bta-Mir-374-P2  Cfa-Mir-374-P2  Hsa-Mir-374-P2  Mml-Mir-374-P2  Mmu-Mir-374-P2  Ocu-Mir-374-P2 
Node of Origin (locus) Eutheria
Node of Origin (family) Eutheria
Genome context
(rn6)
chrX: 74443655-74443706 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-374-P2)
Mir-95-P2 chrX: 74443503-74443558 [-] UCSC Ensembl
Mir-374-P2 chrX: 74443655-74443706 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UGUUCCUCUGAAGAAAUCCUACUCGGAUGGAUAUAAUACAACCUGCUAAGUGUUCUAGCACUUAGCACGUUGUAUUAUUAUUGUCCGAGGCUAUGGCUCUCGUCUAUCAGAA
Get precursor sequence
Structure
        10        20          30        40        50     
UGUUCCUCUGAAGAAAUCCUA--|     UG AU          C         UU 
                       CUCGGA  G  AUAAUACAAC UGCUAAGUG  C
                       GAGCCU  U  UAUUAUGUUG ACGAUUCAC  U
AAGACUAUCUGCUCUCGGUAUCG^     GU AU          C         GA 
110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Mature sequence

Rno-Mir-374-P2_5p

MirBase accessionMIMAT0003208
Sequence
0- AUAUAAUACAACCUGCUAAGUG -22
Get sequence
Validated targets microrna.org: MIMAT0003208
TargetScanVert: rno-miR-374-5p
miRDB: MIMAT0003208
Star sequence

Rno-Mir-374-P2_3p*

MirBase accessionMIMAT0017223
Sequence
30- CUUAGCACGUUGUAUUAUUAUU -52
Get sequence
Validated targets TargetScanVert: rno-miR-374-3p
miRDB: MIMAT0017223