MirGeneDB

MirGeneDB ID

Rno-Mir-361-v2

Family name MIR-361 (all species)
Seed CCCCCAG
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-361
Paralogues Rno-Mir-361-v1 
Orthologues Bta-Mir-361-v2  Cfa-Mir-361-v2  Cpo-Mir-361-v2  Dno-Mir-361-v2  Ete-Mir-361-v2  Hsa-Mir-361-v2  Mml-Mir-361-v2  Mmu-Mir-361-v2  Ocu-Mir-361-v2 
Node of Origin (locus) Eutheria
Node of Origin (family) Eutheria
Genome context
(rn6)
chrX: 84708915-84708974 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-361-v2)
Mir-361-v1 chrX: 84708914-84708975 [-] UCSC Ensembl
Mir-361-v2 chrX: 84708915-84708974 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
ACUAUGAUUCUUUCUUGGGACUCGGAAGCUUAUCAGAAUCUCCAGGGGUACUUAUUAUUUGAAAAGUCCCCCAGGUGUGAUUCUGAUUCGUUUCCCUCUCCUGCUCCUCCUCCUCCUCCU
Get precursor sequence
Structure
        10          20        30        40          50        
ACUAUGAUUCUUUCUUG--   CUC      UU         U--| A    U   UAUUA 
                   GGA   GGAAGC  AUCAGAAUC   CC GGGG ACU     U
                   CCU   CCUUUG  UAGUCUUAG   GG CCCC UGA     U
UCCUCCUCCUCCUCCUCGU   CUC      CU         UGU^ A    C   AAAGU 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
CommentThe mature form of this variant is most highly expressed as a 2 nt shorter form but is rarely accompanied by a 19 nt corresponding 5p star read.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Star sequence

Rno-Mir-361-v2_5p*

MirBase accessionMIMAT0003117
Sequence
0- UAUCAGAAUCUCCAGGGGUACU -22
Get sequence
Validated targets microrna.org: MIMAT0003117
TargetScanVert: rno-miR-361-5p
miRDB: MIMAT0003117
Mature sequence

Rno-Mir-361-v2_3p

MirBase accessionMIMAT0017199
Sequence
36- UCCCCCAGGUGUGAUUCUGAUUCG -60
Get sequence
Validated targets TargetScanVert: rno-miR-361-3p
miRDB: MIMAT0017199