MirGeneDB

MirGeneDB ID

Rno-Mir-346

Family name MIR-346 (all species)
Seed GUCUGCC
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-346
Paralogues
Orthologues Bta-Mir-346  Cfa-Mir-346  Cpo-Mir-346  Ete-Mir-346  Hsa-Mir-346  Mml-Mir-346  Mmu-Mir-346  Ocu-Mir-346 
Node of Origin (locus) Eutheria
Node of Origin (family) Eutheria
Genome context
(rn6)
chr16: 11250069-11250128 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GGCGAUUAGGAGGUCUCUGUGUUGGGCAUCUGUCUGCCUGAGUGCCUGCCUCUCUGUUGCUCUGAAGGAGGCAGGGGCUGGGCCUGCAGCUGCCUGGGCAGAGCUGCUCCUUCGAGGGAC
Get precursor sequence
Structure
        10           20        30        40        50          
GGCGAUUAGGAGGUCUC---|  G UG    U    CU    G   G         CUGUUG 
                    UGU U  GGCA CUGU  GCCU AGU CCUGCCUCU      \
                    ACG G  CCGU GACG  CGGG UCG GGACGGAGG      C
CAGGGAGCUUCCUCGUCGAG^  - GU    C    UC    -   G         AAGUCU 
.       110       100         90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Mature sequence

Rno-Mir-346_5p

MirBase accessionMIMAT0000596
Sequence
0- UGUCUGCCUGAGUGCCUGCCUCU -23
Get sequence
Validated targets microrna.org: MIMAT0000596
TargetScanVert: rno-miR-346
miRDB: MIMAT0000596
Star sequence

Rno-Mir-346_3p*

MirBase accessionNone
Sequence
38- AGGCAGGGGCUGGGCCUGCAGC -60
Get sequence