| MirGeneDB ID | Pau-Mir-2-o111 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-2 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Horseshoe worm (Phoronis australis) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Pau-Mir-2-o109 Pau-Mir-2-o110 Pau-Mir-2-o112 Pau-Mir-2-o113 Pau-Mir-2-P12 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Gsp-Mir-2 Ple-Mir-2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | P. australis | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Protostomia | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (Phoronis_australis_GCA_002633005) |
NMRA01000510.1: 289683-289744 [+] Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-2-o111) |
Mir-71
NMRA01000510.1: 285249-285308 [+]
Ensembl
Mir-2-o109 NMRA01000510.1: 285572-285637 [+] Ensembl Mir-2-P12 NMRA01000510.1: 286403-286457 [+] Ensembl Mir-2-o110 NMRA01000510.1: 288743-288802 [+] Ensembl Mir-2-o111 NMRA01000510.1: 289683-289744 [+] Ensembl Mir-2-o112 NMRA01000510.1: 290853-290908 [+] Ensembl Mir-2-o113 NMRA01000510.1: 291100-291157 [+] Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AUCACAG | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
GAGUGGCCAGUUGUUGCGCGCUGUAGUCGGGUCGUUAAAGUGGCUGUGAUGUGCUAUCACUCAUGACAUAUCACAGCCUGCUUUGACGAGUUGACAGGCACGAUUUAUCCUCUUGACCAAAGGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 GAGUGGCCAGUUGUUGC----|C GUA G - CUAUCA G GCU GUCGG UCGUUAAAGU GGCUGUGAUGUG \ C CGG CAGUU AGCAGUUUCG CCGACACUAUAC C GAAACCAGUUCUCCUAUUUAG^A A-- G U AGUACU 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | It is not clear either from phylogenetic or syntenic information how many Mir-2 genes were present in the last common ancestor of protostomes and how the multiple paralogues in lophotrochozoans relate to the four Mir-2 genes in arthropods. Thus all lophotrochozoan genes aside from Mir-2-P12 are classified as orphans pending further data and analysis. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Pau-Mir-2-o111_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- GUCGUUAAAGUGGCUGUGAUGUG -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Pau-Mir-2-o111_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
38- UAUCACAGCCUGCUUUGACGAGUU -62
Get sequence
|
