MirGeneDB

MirGeneDB ID

Mml-Mir-642

Family name MIR-642 (all species)
Seed UCCCUCU
Species Rhesus monkey (Macaca mulatta)
MiRBase ID mml-mir-642
Paralogues
Orthologues Hsa-Mir-642  Hsa-Mir-642-as 
Node of Origin (locus) Catarrhini
Node of Origin (family) Catarrhini
Genome context
(rheMac8)
chr19: 41017632-41017688 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
ACACUCUCACAGUUUAUCUGAGCUGGGAGGGUCCCUCUCCAAAUGUGUCUUGGGGUGGGGGAUCAAGACACAUUUGGAGAGGGAACCUCCCAACUCGGCCUCAUUGAACUCUCCCAG
Get precursor sequence
Structure
        10          20        30        40        50        
ACACUCUCACAGUUUAU--|    C       G                     GGGUG 
                   CUGAG UGGGAGG UCCCUCUCCAAAUGUGUCUUG     \
                   GGCUC ACCCUCC AGGGAGAGGUUUACACAGAAC     G
GACCCUCUCAAGUUACUCC^    A       A                     UAGGG 
     110       100        90        80        70        60
Deep sequencing
3' NTU Unknown
MotifsNo
Tissue expression
 +
Bo Br Br Br He Ki Li Lu Ly Sk Sp Te Th
Mature sequence

Mml-Mir-642_5p (predicted)

MirBase accessionMIMAT0006483
Sequence
0- GUCCCUCUCCAAAUGUGUCUUG -22
Get sequence
Validated targets TargetScanVert: mml-miR-642
Star sequence

Mml-Mir-642_3p* (predicted)

MirBase accessionNone
Sequence
35- AGACACAUUUGGAGAGGGAACC -57
Get sequence