MirGeneDB

MirGeneDB ID

Hsa-Mir-642

Family name MIR-642 (all species)
Seed UCCCUCU
Species Human (Homo sapiens)
MiRBase ID hsa-mir-642a
Paralogues Hsa-Mir-642-as 
Orthologues Mml-Mir-642 
Node of Origin (locus) Catarrhini
Node of Origin (family) Catarrhini
Genome context
(hg38)
chr19: 45674943-45674999 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-642)
Mir-642-as chr19: 45674941-45674997 [-] UCSC Ensembl
Mir-642 chr19: 45674943-45674999 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CACUCUCCACAGUUUAUCUGAGUUGGGAGGGUCCCUCUCCAAAUGUGUCUUGGGGUGGGGGAUCAAGACACAUUUGGAGAGGGAACCUCCCAACUCGGCCUCUGCCAUCAUUUAACU
Get precursor sequence
Structure
        10          20        30        40        50        
CACUCUCCACAGUUUAU--|            G                     GGGUG 
                   CUGAGUUGGGAGG UCCCUCUCCAAAUGUGUCUUG     \
                   GGCUCAACCCUCC AGGGAGAGGUUUACACAGAAC     G
UCAAUUUACUACCGUCUCC^            A                     UAGGG 
     110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Bo Bo Bo Bo Br Br Ce Co Fo He Ki Li Li Lu Pa Pl Sk Sk Sk Sm Sp Sp St Te Th Ut
Mature sequence

Hsa-Mir-642_5p

MirBase accessionMIMAT0003312
Sequence
0- GUCCCUCUCCAAAUGUGUCUUG -22
Get sequence
Validated targets microrna.org: MIMAT0003312
TargetScanVert: hsa-miR-642a-5p
TargetMiner: hsa-miR-642a-5p
miRDB: MIMAT0003312
Co-mature sequence

Hsa-Mir-642_3p

MirBase accessionMIMAT0020924
Sequence
35- AGACACAUUUGGAGAGGGAACC -57
Get sequence
Validated targets TargetScanVert: hsa-miR-642a-3p
TargetMiner: hsa-miR-642a-3p
miRDB: MIMAT0020924