MirGeneDB

MirGeneDB ID

Lgi-Mir-2722

Family name MIR-2722 (all species)
Seed AGGUGUU
Species Owl limpet (Lottia gigantea)
MiRBase ID lgi-mir-2722
Paralogues
Orthologues Cgi-Mir-2722 
Node of Origin (locus) Mollusca
Node of Origin (family) Mollusca
Genome context
(Lotgi1)
955868772_BGOB50479: 333-388 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
GAUGGAAUUUGGAUGGUUGACCCCACUGGAGAGGUGUUUCAUAGGCGCUACAGUGGAAGUGACGUGGCGCCGUGGAAACAUCUACCUAGUGCGGUUGUAAAUUCUACAGAUCCAGA
Get precursor sequence
Structure
        10          20        30        40        50       
GAUGGAAUUUGGAUGGUU--|   C      AG         AUA        AGUGG 
                    GACC CACUGG  AGGUGUUUC   GGCGCUAC     A
                    UUGG GUGAUC  UCUACAAAG   CCGCGGUG     A
AGACCUAGACAUCUUAAAUG^   C      CA         GUG        CAGUG 
    110       100        90        80        70        60
Deep sequencing
Go to detailed chart
CommentNot in assembly but in trace archive (BGOB50479.y1).
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
To
Mature sequence

Lgi-Mir-2722_5p

MirBase accessionNone
Sequence
0- GAGGUGUUUCAUAGGCGCUACA -22
Get sequence
Co-mature sequence

Lgi-Mir-2722_3p

MirBase accessionMIMAT0013589
Sequence
34- UGGCGCCGUGGAAACAUCUACC -56
Get sequence