MirGeneDB ID | Laf-Mir-328 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Family name | MIR-328 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Species | African bush elephant (Loxodonta africana) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Paralogues | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Orthologues | Bta-Mir-328 Cfa-Mir-328 Cja-Mir-328 Cpo-Mir-328 Dno-Mir-328 Eca-Mir-328 Ete-Mir-328 Hsa-Mir-328 Mml-Mir-328 Mmr-Mir-328 Mmu-Mir-328 Ocu-Mir-328 Pab-Mir-328 Rno-Mir-328 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (locus) | Eutheria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (family) | Eutheria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genome context (GCA_000001905.1_Loxafr3.0) |
GL010075.1: 8612958-8613018 [-] UCSC Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Seed | UGGCCCU | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Precursor (pre-Mir +30nt flank) |
AAGUCCUGGGCCGUCUCGGAACCUGGAGCGGGGGGGCAGGAGGGGCUCAGGGAGGUAGUGUGUGUAGCCCCUGGCCCUCUCUGCCCUUCCGUCCCUGUCCCCGGACACACUGUGCCCAGUUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Structure | 10 20 30 40 50 60 AAGUCCUGGGCCGUCUC----| ACCU AG GA U GAGGUAGU GGA GG CGGGGGGGCAG GGGGC CAGG G CCU CC GCCUUCCCGUC UCCCG GUCC U UUGACCCGUGUCACACAGGCC^ GU-- CU UC - CCGAUGUG . 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Comment | Although there is a templated T at the 3' end of the 3p arm, the post-transcriptional addition of a terminal 3' U is supported by the 3' offset reads in cow in addition to the 3p reads in armadillo where the T is not templated. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3' NTU | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Motifs | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Star sequence | Laf-Mir-328_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
0- GGGGGGCAGGAGGGGCUCAGG -21
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mature sequence | Laf-Mir-328_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
40- CUGGCCCUCUCUGCCCUUCCG -61
Get sequence
|