MirGeneDB

MirGeneDB ID

Dan-Mir-929

Family name MIR-929 (all species)
Seed AAUUGAC
Species Fruit fly (Drosophila ananassae)
MiRBase ID
Paralogues
Orthologues Aae-Mir-929-P1  Aae-Mir-929-P2  Bge-Mir-929-v1  Bge-Mir-929-v2  Dme-Mir-929  Dmo-Mir-929  Hme-Mir-929  Tca-Mir-929 
Node of Origin (locus) Pterygota
Node of Origin (family) Pterygota
Genome context
(Dana_caf1)
scaffold_13340: 11127750-11127807 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
CAACCAACCAACCACUUCCUGGCGCAGUUCAAAUUGACUCUAGUAGGGAGUCCUUUUAACGAGAGACUCCCUAACGGAGUCAGAUUGAAUUACAAAGGAGCGAGACAACGACUACGUG
Get precursor sequence
Structure
        10           20        30        40        50        
CAACCAACCAACCACUU---|  GGCGC       A        AG         CUUUU 
                    CCU     AGUUCAA UUGACUCU  UAGGGAGUC     A
                    GGA     UUAAGUU GACUGAGG  AUCCCUCAG     A
GUGCAUCAGCAACAGAGCGA^  AACA-       A        CA         AGAGC 
      110       100         90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Da
Mature sequence

Dan-Mir-929_5p

MirBase accessionNone
Sequence
0- AAAUUGACUCUAGUAGGGAGUC -22
Get sequence
Star sequence

Dan-Mir-929_3p*

MirBase accessionNone
Sequence
36- CUCCCUAACGGAGUCAGAUUGA -58
Get sequence