MirGeneDB

MirGeneDB ID

Cpo-Mir-374-P1

Family name MIR-374 (all species)
Seed UAUAAUA
Species Guinea pig (Cavia porcellus)
MiRBase ID cpo-mir-374
Paralogues
Orthologues Bta-Mir-374-P1  Cfa-Mir-374-P1  Dno-Mir-374-P1  Hsa-Mir-374-P1  Mml-Mir-374-P1  Ocu-Mir-374-P1 
Node of Origin (locus) Eutheria
Node of Origin (family) Eutheria
Genome context
(cavPor3)
scaffold_26: 22992971-22993022 [+] UCSC
Clustered MiRNAs
(< 10kb from Mir-374-P1)
Mir-374-P1 scaffold_26: 22992971-22993022 [+] UCSC
Mir-95-P3-v1 scaffold_26: 22993124-22993186 [+] UCSC
Mir-95-P3-v2 scaffold_26: 22993126-22993185 [+] UCSC
Precursor
(pre-Mir +30nt flank)
ACCCUUUGGAAAGAUAUUUUACAUAGGCCUUUAUAAUACAACCUGAUAAGUGUUAUAACACUUACCAGAUUGUAUUGUAAUUGUCUGUGUAUAUAUCUGUCUAUCUUCCUAU
Get precursor sequence
Structure
        10          20        30        40        50     
ACCCUUUGGAAAGAUAUUU--|        CU           C   A      UU 
                     UACAUAGGC  UUAUAAUACAA CUG UAAGUG  A
                     AUGUGUCUG  AAUGUUAUGUU GAC AUUCAC  U
UAUCCUUCUAUCUGUCUAUAU^        UU           A   C      AA 
110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
To
Mature sequence

Cpo-Mir-374-P1_5p

MirBase accessionMIMAT0047205
Sequence
0- UUAUAAUACAACCUGAUAAGUG -22
Get sequence
Co-mature sequence

Cpo-Mir-374-P1_3p

MirBase accessionMIMAT0047206
Sequence
30- CUUACCAGAUUGUAUUGUAAUU -52
Get sequence