MirGeneDB

MirGeneDB ID

Cli-Mir-1552

Family name MIR-1552 (all species)
Seed UAGUGCG
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-1552
Paralogues
Orthologues Gga-Mir-1552  Tgu-Mir-1552 
Node of Origin (locus) Neognathae
Node of Origin (family) Neognathae
Genome context
(colLiv2)
scaffold160: 1494072-1494129 [-]
Precursor
(pre-Mir +30nt flank)
AGCAGCUUAGUGCUUGUCUACACGGGGAAGUUAGUGCGCGGUAAGCUAGGGUGUGAGUUUGCAGCACGCUAGCUGCUCUGCACUAACUCCCCCUGUGGAUGCUGAGUGUGCACUAAGA
Get precursor sequence
Structure
        10           20        30        40        50         
AGCAGCUUAGUGCUUGU---|    C     A         C    A     G   UGAGU 
                    CUACA GGGGA GUUAGUGCG GGUA GCUAG GUG     \
                    GGUGU CCCCU CAAUCACGU UCGU CGAUC CAC     U
AGAAUCACGUGUGAGUCGUA^    C     -         C    -     G   GACGU 
      110       100        90         80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
To
Mature sequence

Cli-Mir-1552_5p

MirBase accessionMIMAT0038683
Sequence
0- UUAGUGCGCGGUAAGCUAGGGUG -23
Get sequence
Co-mature sequence

Cli-Mir-1552_3p

MirBase accessionMIMAT0038684
Sequence
36- CGCUAGCUGCUCUGCACUAACU -58
Get sequence