MirGeneDB

MirGeneDB ID

Cbr-Mir-2222-P1a

Family name MIR-2222 (all species)
Seed AUCACAA
Species Roundworm (Caenorhabditis briggsae)
MiRBase ID cbr-mir-2222-1
Paralogues Cbr-Mir-2222-P1b  Cbr-Mir-2222-P2a  Cbr-Mir-2222-P2b 
Orthologues
Node of Origin (locus) C. briggsae
Node of Origin (family) C. briggsae
Genome context
(CB4)
X: 20535807-20535871 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-2222-P1a)
Mir-7587 X: 20533902-20533963 [+] Ensembl
Mir-2222-P1a X: 20535807-20535871 [+] Ensembl
Mir-2222-P1b X: 20537177-20537241 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
UCAUGAAUGGUCAGGUUACCAGUCGACCUGUGCUGCCUCUUUCUUUCGUGAUAUUUUUCACAGCGUAAAAAUAUCACAAGAACAGAUCCAGCACAGGUCGUUUACCUGACAUUUAUUCUGCUAUU
Get precursor sequence
Structure
        10        20          30        40         50        60  
UCAUGAAUGGUCAGGUUACCAGU--            CC   -|    UC        UUUCAC 
                         CGACCUGUGCUG  UCU UUCUU  GUGAUAUU      A
                         GCUGGACACGAC  AGA AAGAA  CACUAUAA      G
UUAUCGUCUUAUUUACAGUCCAUUU            CU   C^    --        AAAUGC 
   120       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 Cb Ea Ma Yo
Star sequence

Cbr-Mir-2222-P1a_5p*

MirBase accessionNone
Sequence
0- UGCUGCCUCUUUCUUUCGUGAUAUU -25
Get sequence
Mature sequence

Cbr-Mir-2222-P1a_3p

MirBase accessionMIMAT0011487
Sequence
41- UAUCACAAGAACAGAUCCAGCACA -65
Get sequence