MirGeneDB

MirGeneDB ID

Ami-Mir-7463

Family name MIR-7463 (all species)
Seed UUACUUU
Species American alligator (Alligator mississippiensis)
MiRBase ID
Paralogues
Orthologues Cli-Mir-7463  Cpi-Mir-7463  Gga-Mir-7463  Tgu-Mir-7463 
Node of Origin (locus) Archelosauria
Node of Origin (family) Archelosauria
Genome context
(allMis1)
JH734522: 530813-530874 [+] UCSC
Precursor
(pre-Mir +30nt flank)
UAUUACCAUGUUAUUAUGGAUAGUAUAGACUGAGUCUCCUUGAAAGUAAUGGCAUGUGAUUGCUUACCCCAUUACUUUCAAUGGGACUAAGUCUAUGUCAUCCUUAGGGACUCAAUCCCAUU
Get precursor sequence
Structure
        10          20        30        40        50        60
UAUUACCAUGUUAUUAU--|   AG        G      C             CAUGUGA 
                   GGAU  UAUAGACU AGUCUC UUGAAAGUAAUGG       U
                   CCUA  GUAUCUGA UCAGGG AACUUUCAUUACC       U
UUACCCUAACUCAGGGAUU^   CU        A      U             CCAUUCG 
120       110       100        90        80        70
Deep sequencing
3' NTU Unknown
MotifsUG at 5p(-14)
Tissue expression
 +
To
Star sequence

Ami-Mir-7463_5p* (predicted)

MirBase accessionNone
Sequence
0- UGAGUCUCCUUGAAAGUAAUGG -22
Get sequence
Mature sequence

Ami-Mir-7463_3p (predicted)

MirBase accessionNone
Sequence
40- AUUACUUUCAAUGGGACUAAGU -62
Get sequence