MirGeneDB

MirGeneDB ID

Aca-Mir-203-v2

Family name MIR-203 (all species)
Seed GAAAUGU
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-203
Paralogues Aca-Mir-203-v1 
Orthologues Ami-Mir-203-v2  Bta-Mir-203-v2  Cfa-Mir-203-v2  Cpi-Mir-203-v2  Cpo-Mir-203-v2  Dno-Mir-203-v2  Ete-Mir-203-v2  Gga-Mir-203-v2  Hsa-Mir-203-v2  Mdo-Mir-203-v2  Mml-Mir-203-v2  Mmu-Mir-203-v2  Oan-Mir-203-v2  Rno-Mir-203-v2  Sha-Mir-203-v2  Sto-Mir-203-v2  Tgu-Mir-203-v2  Xtr-Mir-203-v2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
1: 5622445-5622504 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-203-v2)
Mir-203-v1 1: 5622445-5622504 [-] UCSC Ensembl
Mir-203-v2 1: 5622445-5622504 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCAUCCUCCAAAUCCAAGCCUGCUGGGUGCAGUGGUUCUUAACAGUUCAACAGUUCUCUAUUAUAAUUGUGAAAUGUUUAGGACCACUUGAUCCGGCGGGCCCAGGCAACACAUGCUGGA
Get precursor sequence
Structure
        10          20        30        40        50          
CCAUCCUCCAAAUCCAA--|          GC         U    G    A  GUUCUCU 
                   GCCUGCUGGGU  AGUGGUUCU AACA UUCA CA       \
                   CGGGCGGCCUA  UCACCAGGA UUGU AAGU GU       A
AGGUCGUACACAACGGACC^          GU         U    A    -  UAAUAUU 
.       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Star sequence

Aca-Mir-203-v2_5p*

MirBase accessionMIMAT0021851
Sequence
0- AGUGGUUCUUAACAGUUCAACA -22
Get sequence
Mature sequence

Aca-Mir-203-v2_3p

MirBase accessionMIMAT0021852
Sequence
39- UGAAAUGUUUAGGACCACUUG -60
Get sequence