MirGeneDB

Gene name

Pfl-Mir-375

Family name MIR-375 (all species)
MiRBase ID
Paralogues
Orthologues Aca-Mir-375  Ami-Mir-375  Asu-Mir-375  Bfl-Mir-375  Bta-Mir-375  Cel-Mir-375  Cfa-Mir-375  Cgi-Mir-375-P3  Cgi-Mir-375-P4  Cli-Mir-375  Cpi-Mir-375  Cpo-Mir-375  Cte-Mir-375  Dme-Mir-375  Dno-Mir-375  Dpu-Mir-375  Dre-Mir-375-P1  Dre-Mir-375-P2  Efe-Mir-375  Ete-Mir-375  Gga-Mir-375  Hsa-Mir-375  Isc-Mir-375  Lgi-Mir-375  Mdo-Mir-375  Mml-Mir-375  Mmu-Mir-375  Ocu-Mir-375  Pmi-Mir-375  Rno-Mir-375  Sha-Mir-375  Sko-Mir-375  Spu-Mir-375  Tca-Mir-375  Xtr-Mir-375 
Node of Origin (gene) Bilateria
Node of Origin (family) Bilateria
Genome context
(Pfl)
LD344517.1: 177550-177613 [-]
Precursor
(pre-Mir +30nt flank)
GUUACUCAAAGGAUCGUGCGCUGGCUGAUUCCACGAGCCUCACGACCACGGCUGUCACAAUCUAUGAAUGGCUUUGUUCGUUCGGCUCGCGUGAUUAAACGGCGCUUUUGCAACUCAUCUUCUG
Get precursor sequence
Structure
        10          20        30        40        50        60 
GUUACUCAAAGGAUCGU--|     GC     CCA      UC    C  C   UGUCACAA 
                   GCGCUG  UGAUU   CGAGCC  ACGA CA GGC        U
                   CGCGGC  AUUAG   GCUCGG  UGCU GU UCG        C
GUCUUCUACUCAACGUUUU^     AA     UGC      CU    U  U   GUAAGUAU 
  120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Pt
Star sequence

Pfl-Mir-375_5p* (predicted)

MirBase accessionNone
Sequence
0- CCACGAGCCUCACGACCACGGC -22
Get sequence
Mature sequence

Pfl-Mir-375_3p

MirBase accessionNone
Sequence
42- UUUGUUCGUUCGGCUCGCGUGA -64
Get sequence
Seed sequenceUUGUUCG