MirGeneDB

Gene name

Cin-Mir-375

Family name MIR-375 (all species)
MiRBase ID cin-mir-375
Paralogues
Orthologues Aae-Mir-375  Aca-Mir-375  Ami-Mir-375  Asu-Mir-375  Bfl-Mir-375  Bge-Mir-375  Bta-Mir-375  Cbr-Mir-375  Cel-Mir-375  Cfa-Mir-375  Cgi-Mir-375-P3  Cgi-Mir-375-P4  Cli-Mir-375  Cpi-Mir-375  Cpo-Mir-375  Cte-Mir-375  Dan-Mir-375  Dme-Mir-375  Dmo-Mir-375  Dno-Mir-375  Dpu-Mir-375  Dre-Mir-375-P1  Dre-Mir-375-P2  Efe-Mir-375  Ete-Mir-375  Gga-Mir-375  Hme-Mir-375  Hsa-Mir-375  Isc-Mir-375  Lan-Mir-375  Lgi-Mir-375  Mdo-Mir-375  Mml-Mir-375  Mmu-Mir-375  Ocu-Mir-375  Pfl-Mir-375  Pmi-Mir-375  Rno-Mir-375  Sha-Mir-375  Sko-Mir-375  Spu-Mir-375  Tca-Mir-375  Tgu-Mir-375  Xtr-Mir-375 
Node of Origin (gene) Bilateria
Node of Origin (family) Bilateria
Genome context
(Ciona_KH)
7: 372868-372952 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CUGUCAGCUCAUUUUAUUGUUGUUAUGGCAACGUUGGUCGCACGAUCAAAGCGUCAUUAUUGUUCUGGCGUCAUUAAUUGCGUCAUAAAAUGCCUUGUUCGUUCGGCUCGCGUCUUCAUGAUAAUAACUUUCUUCAAGGACUUUA
Get precursor sequence
Structure
        10          20        30        40        50        60        70  
CUGUCAGCUCAUUUUAU--|          CA    U     C    U   A  GUCAUUAUUGUUCUGGCGU 
                   UGUUGUUAUGG  ACGU GGUCG ACGA CAA GC                   \
                   AUAAUAGUACU  UGCG UCGGC UGCU GUU CG                   C
AUUUCAGGAACUUCUUUCA^          UC    C     U    U   C  UAAAAUACUGCGUUAAUUA 
   140       130       120       110       100        90        80
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Cr Cr Cr Cr Cr Cr Cr Cr Cr Cr Ga La La
Star sequence

Cin-Mir-375_5p*

MirBase accessionMIMAT0016417
Sequence
0- ACGUUGGUCGCACGAUCAAAGC -22
Get sequence
Mature sequence

Cin-Mir-375_3p

MirBase accessionMIMAT0016418
Sequence
63- CUUGUUCGUUCGGCUCGCGUCU -85
Get sequence
Seed sequenceUUGUUCG