MirGeneDB

Gene name

Tca-Mir-375

Family name MIR-375 (all species)
MiRBase ID tca-mir-375
Paralogues
Orthologues Aca-Mir-375  Ami-Mir-375  Asu-Mir-375  Bfl-Mir-375  Bta-Mir-375  Cel-Mir-375  Cfa-Mir-375  Cgi-Mir-375-P3  Cgi-Mir-375-P4  Cli-Mir-375  Cpi-Mir-375  Cpo-Mir-375  Cte-Mir-375  Dme-Mir-375  Dno-Mir-375  Dpu-Mir-375  Dre-Mir-375-P1  Dre-Mir-375-P2  Efe-Mir-375  Ete-Mir-375  Gga-Mir-375  Hsa-Mir-375  Isc-Mir-375  Lgi-Mir-375  Mdo-Mir-375  Mml-Mir-375  Mmu-Mir-375  Ocu-Mir-375  Pfl-Mir-375  Pmi-Mir-375  Rno-Mir-375  Sha-Mir-375  Sko-Mir-375  Spu-Mir-375  Xtr-Mir-375 
Node of Origin (gene) Bilateria
Node of Origin (family) Bilateria
Genome context
(Tcas5.2)
LG8: 13678592-13678651 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
CUUGGUGGUGUUUUUGUUACAUUCAAACUGACUUGAGCCUUGCGAAUAAUUCCUAAUUUAAAGAGCGAUUUGUUCGUGUGGCUCGAGUUAGAUAAAAUGUCUUUCCCCCAAUUAUCGUGA
Get precursor sequence
Structure
        10          20        30        40        50         
CUUGGUGGUGUUUUUGUU--|    CAAA            U         U  CUAAUU 
                    ACAUU    CUGACUUGAGCC UGCGAAUAA UC      U
                    UGUAA    GAUUGAGCUCGG GUGCUUGUU AG      A
AGUGCUAUUAACCCCCUUUC^    AAUA            U         U  CGAGAA 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Ea Em Em Em Em Em Oo
Star sequence

Tca-Mir-375_5p*

MirBase accessionMIMAT0018794
Sequence
0- ACUUGAGCCUUGCGAAUAAUUCC -23
Get sequence
Mature sequence

Tca-Mir-375_3p

MirBase accessionMIMAT0018795
Sequence
38- UUUGUUCGUGUGGCUCGAGUUA -60
Get sequence
Seed sequenceUUGUUCG