MirGeneDB

MirGeneDB ID

Asu-Mir-375

Family name MIR-375 (all species)
Seed UUGUUCG
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-375
Paralogues
Orthologues Aae-Mir-375  Aca-Mir-375  Ami-Mir-375  Bfl-Mir-375  Bge-Mir-375  Bta-Mir-375  Cbr-Mir-375  Cel-Mir-375  Cfa-Mir-375  Cgi-Mir-375-P3  Cgi-Mir-375-P4  Cin-Mir-375  Cli-Mir-375  Cpi-Mir-375  Cpo-Mir-375  Cte-Mir-375  Dan-Mir-375  Dme-Mir-375  Dmo-Mir-375  Dno-Mir-375  Dpu-Mir-375  Dre-Mir-375-P1  Dre-Mir-375-P2  Efe-Mir-375  Ete-Mir-375  Gga-Mir-375  Hme-Mir-375  Hsa-Mir-375  Isc-Mir-375  Lan-Mir-375  Lgi-Mir-375  Mdo-Mir-375  Mml-Mir-375  Mmu-Mir-375  Oan-Mir-375  Ocu-Mir-375  Pfl-Mir-375  Pmi-Mir-375  Rno-Mir-375  Sha-Mir-375  Sko-Mir-375  Spu-Mir-375  Sto-Mir-375  Tca-Mir-375  Tgu-Mir-375  Xtr-Mir-375 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold53: 8412-8477 [-]
Precursor
(pre-Mir +30nt flank)
UCGAGACGCAAACUGUAUCGGUUUUCACUCUUCGCAAGCGAACUGAUCAAAACCCACACUCGGUGACGGACGUUUUGUUCGUUUUGCUUGCGAUCAGUGCGAGCGUACGAUAAAUCAUACAUCCAU
Get precursor sequence
Structure
        10        20          30        40        50        60  
UCGAGACGCAAACUGUAUCG--|   U    CU           C   U      CCACACUC 
                      GUUU CACU  UCGCAAGCGAA UGA CAAAAC        G
                      CGAG GUGA  AGCGUUCGUUU GCU GUUUUG        G
UACCUACAUACUAAAUAGCAUG^   C    CU           U   U      CAGGCAGU 
    120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Star sequence

Asu-Mir-375_5p*

MirBase accessionMIMAT0021525
Sequence
0- UUCGCAAGCGAACUGAUCAAAAC -23
Get sequence
Mature sequence

Asu-Mir-375_3p

MirBase accessionMIMAT0021526
Sequence
43- UUUGUUCGUUUUGCUUGCGAUCA -66
Get sequence